Incidental Mutation 'R7138:Tonsl'
ID553227
Institutional Source Beutler Lab
Gene Symbol Tonsl
Ensembl Gene ENSMUSG00000059323
Gene Nametonsoku-like, DNA repair protein
SynonymsNfkbil2, 2810439M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7138 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76626002-76639958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76634776 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 519 (V519A)
Ref Sequence ENSEMBL: ENSMUSP00000129597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165190] [ENSMUST00000166974] [ENSMUST00000168185]
Predicted Effect probably benign
Transcript: ENSMUST00000165190
SMART Domains Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 4e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
low complexity region 259 271 N/A INTRINSIC
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166974
Predicted Effect probably benign
Transcript: ENSMUST00000168185
AA Change: V519A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: V519A

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 7e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
Pfam:TPR_8 242 274 8.7e-3 PFAM
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
low complexity region 413 437 N/A INTRINSIC
low complexity region 465 494 N/A INTRINSIC
low complexity region 500 511 N/A INTRINSIC
ANK 528 559 8.36e1 SMART
ANK 561 590 4.85e-8 SMART
ANK 597 626 2.85e-5 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
LRR 1058 1085 2.86e-1 SMART
LRR 1086 1113 5.88e-1 SMART
LRR 1117 1144 1.67e-2 SMART
LRR 1177 1204 2.72e0 SMART
LRR 1236 1263 7.02e0 SMART
LRR 1264 1292 1.46e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T A 16: 13,677,725 D229E probably benign Het
Abca4 T A 3: 122,105,464 C698* probably null Het
Acacb G A 5: 114,207,326 V947M probably benign Het
Acadsb T G 7: 131,441,239 L343R probably damaging Het
Adgrf2 C T 17: 42,710,983 E317K probably damaging Het
Agap2 A G 10: 127,087,285 T663A unknown Het
Akap8 A T 17: 32,316,541 F166L possibly damaging Het
Ankrd17 A T 5: 90,242,977 M2278K probably benign Het
Avl9 T C 6: 56,728,257 S148P probably damaging Het
Brf1 T C 12: 112,970,215 E266G probably damaging Het
Cabin1 T C 10: 75,745,353 K380E probably damaging Het
Catsper2 T C 2: 121,397,063 D542G possibly damaging Het
Cbln4 C A 2: 172,042,175 D42Y probably damaging Het
Cd5 C T 19: 10,720,304 R437Q probably damaging Het
Ceacam18 G C 7: 43,639,282 E152D possibly damaging Het
Chd8 A G 14: 52,214,498 S1347P possibly damaging Het
Chodl T G 16: 78,941,447 I101R probably damaging Het
Clk4 T G 11: 51,277,932 F377L probably damaging Het
Cntnap3 C T 13: 64,781,725 probably null Het
Dab2 A G 15: 6,429,299 S231G probably benign Het
Disp2 T A 2: 118,786,880 H118Q probably benign Het
Dnah10 T C 5: 124,822,945 F3869S probably damaging Het
Edil3 C T 13: 89,131,728 T175I probably damaging Het
Fap A G 2: 62,542,178 S319P probably benign Het
Frmpd2 T A 14: 33,571,804 V1309E probably benign Het
Galntl5 T A 5: 25,189,844 S70T probably benign Het
Gm16368 T G 12: 88,083,878 I61R probably damaging Het
Gm21994 T C 2: 150,255,452 H47R probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gna15 G A 10: 81,508,047 T260M probably damaging Het
Gucy2c A G 6: 136,728,344 I531T probably damaging Het
Heatr5b A G 17: 78,827,988 V238A probably damaging Het
Htr2a A G 14: 74,705,742 Y254C probably damaging Het
Inpp5b A G 4: 124,785,272 R491G probably damaging Het
Kcnt2 C T 1: 140,596,040 L1093F possibly damaging Het
Kcp C A 6: 29,491,862 E922* probably null Het
Lrp2 G A 2: 69,465,745 A3340V possibly damaging Het
Lrrn1 T G 6: 107,568,375 V378G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Net1 G A 13: 3,888,510 R126C probably damaging Het
Nipsnap3a T C 4: 52,993,978 C20R probably benign Het
Nxpe2 C T 9: 48,320,706 C317Y probably damaging Het
Olfr1418 T A 19: 11,855,288 I222F probably damaging Het
Olfr145 T C 9: 37,898,064 I220T probably damaging Het
Olfr648 T C 7: 104,180,297 Y37C probably damaging Het
Olfr969 T G 9: 39,795,790 Y138* probably null Het
Orm1 T A 4: 63,344,712 W39R probably damaging Het
Pds5b A T 5: 150,800,677 K1240* probably null Het
Pdss1 T A 2: 22,912,669 H173Q probably damaging Het
Pebp1 A G 5: 117,285,817 W84R probably damaging Het
Pla2g16 T A 19: 7,579,185 V117E probably damaging Het
Pla2g4e C T 2: 120,171,278 C630Y probably damaging Het
Plekho2 G T 9: 65,556,353 Q405K probably benign Het
Plppr2 T A 9: 21,944,412 V227E probably damaging Het
Rapgef4 T C 2: 72,198,363 S393P probably damaging Het
Rapgefl1 A G 11: 98,847,074 probably null Het
Ripk3 C A 14: 55,788,346 R19L probably benign Het
Rnase10 G T 14: 51,009,710 V182F probably damaging Het
Rsf1 T A 7: 97,669,795 S917R Het
Sephs2 T C 7: 127,273,015 N302S possibly damaging Het
Slc13a2 C T 11: 78,399,124 V455M possibly damaging Het
Slc30a2 A T 4: 134,344,118 D54V probably benign Het
Slco6c1 T C 1: 97,119,981 E199G possibly damaging Het
Snx27 A T 3: 94,528,940 M256K probably benign Het
Spag4 T A 2: 156,066,599 S150T probably benign Het
Spon1 T A 7: 114,036,710 C720S probably damaging Het
Tbc1d22a T C 15: 86,239,155 S166P probably benign Het
Tbc1d9 T C 8: 83,210,484 I65T probably damaging Het
Tmem176a T A 6: 48,844,019 V141D probably damaging Het
Tmem268 G A 4: 63,562,450 probably benign Het
Ttn G A 2: 76,782,032 P17204S possibly damaging Het
Wisp3 T A 10: 39,158,477 Q43L possibly damaging Het
Wrap53 T A 11: 69,563,868 D225V probably benign Het
Zfhx4 G A 3: 5,412,047 A3241T possibly damaging Het
Znfx1 T C 2: 167,056,777 R76G probably benign Het
Other mutations in Tonsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tonsl APN 15 76638496 missense possibly damaging 0.78
IGL00763:Tonsl APN 15 76633868 missense probably damaging 1.00
IGL00796:Tonsl APN 15 76625149 missense probably benign
IGL00965:Tonsl APN 15 76631880 splice site probably benign
IGL01434:Tonsl APN 15 76631102 missense probably benign 0.11
IGL01859:Tonsl APN 15 76634780 missense probably damaging 0.97
IGL02112:Tonsl APN 15 76633402 missense probably benign 0.01
IGL02189:Tonsl APN 15 76623178 missense possibly damaging 0.56
IGL02281:Tonsl APN 15 76634074 missense probably damaging 1.00
IGL02627:Tonsl APN 15 76634095 missense probably damaging 0.99
IGL02750:Tonsl APN 15 76633389 missense probably damaging 0.97
IGL02977:Tonsl APN 15 76632873 missense probably benign 0.00
R0127:Tonsl UTSW 15 76633485 missense probably benign 0.01
R0316:Tonsl UTSW 15 76629300 missense possibly damaging 0.68
R0443:Tonsl UTSW 15 76639684 missense probably benign
R0714:Tonsl UTSW 15 76633721 splice site probably benign
R0946:Tonsl UTSW 15 76623221 missense probably benign 0.03
R0975:Tonsl UTSW 15 76638932 missense probably damaging 0.99
R1263:Tonsl UTSW 15 76622562 missense possibly damaging 0.85
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1610:Tonsl UTSW 15 76638557 missense probably damaging 1.00
R1623:Tonsl UTSW 15 76638509 missense probably damaging 1.00
R1763:Tonsl UTSW 15 76638066 missense probably damaging 1.00
R1882:Tonsl UTSW 15 76624150 missense possibly damaging 0.83
R1898:Tonsl UTSW 15 76638853 unclassified probably null
R1932:Tonsl UTSW 15 76624597 missense probably damaging 0.97
R2141:Tonsl UTSW 15 76632661 missense probably damaging 0.99
R2166:Tonsl UTSW 15 76637313 missense probably benign 0.13
R2191:Tonsl UTSW 15 76632680 missense probably damaging 0.96
R2198:Tonsl UTSW 15 76636672 missense probably benign 0.00
R2219:Tonsl UTSW 15 76634640 missense probably damaging 1.00
R2762:Tonsl UTSW 15 76630620 missense probably damaging 1.00
R3156:Tonsl UTSW 15 76639521 missense probably damaging 1.00
R3508:Tonsl UTSW 15 76639756 missense probably benign
R4012:Tonsl UTSW 15 76637044 missense probably damaging 1.00
R4179:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4180:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4327:Tonsl UTSW 15 76639716 missense probably benign
R4627:Tonsl UTSW 15 76637224 missense probably damaging 1.00
R4671:Tonsl UTSW 15 76623410 missense probably benign 0.01
R4825:Tonsl UTSW 15 76633248 missense probably benign 0.34
R4840:Tonsl UTSW 15 76633209 missense probably benign
R5030:Tonsl UTSW 15 76638101 missense probably damaging 1.00
R5143:Tonsl UTSW 15 76636657 missense possibly damaging 0.80
R6238:Tonsl UTSW 15 76636218 unclassified probably null
R6379:Tonsl UTSW 15 76629742 missense probably benign
R6401:Tonsl UTSW 15 76633666 missense probably damaging 1.00
R6534:Tonsl UTSW 15 76629677 missense probably damaging 1.00
R6695:Tonsl UTSW 15 76629818 missense possibly damaging 0.84
R6701:Tonsl UTSW 15 76629300 missense probably damaging 1.00
R7206:Tonsl UTSW 15 76633651 missense probably damaging 1.00
R7287:Tonsl UTSW 15 76633725 intron probably null
R7615:Tonsl UTSW 15 76630607 missense probably benign 0.44
R7626:Tonsl UTSW 15 76633936 missense probably null 1.00
R7641:Tonsl UTSW 15 76633652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGATCCTGGACACGACG -3'
(R):5'- GCTTTGCTTAACCTGGCTAC -3'

Sequencing Primer
(F):5'- AGTTGGCCTTCAATGCAAGC -3'
(R):5'- TGGCTACAGAACTCCCAGGTC -3'
Posted On2019-05-15