Incidental Mutation 'R7138:Tbc1d22a'
ID553228
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene NameTBC1 domain family, member 22a
SynonymsD15Ertd781e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7138 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location86214459-86498503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86239155 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 166 (S166P)
Ref Sequence ENSEMBL: ENSMUSP00000065721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414] [ENSMUST00000229242]
Predicted Effect probably benign
Transcript: ENSMUST00000063414
AA Change: S166P

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: S166P

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229242
AA Change: S130P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T A 16: 13,677,725 D229E probably benign Het
Abca4 T A 3: 122,105,464 C698* probably null Het
Acacb G A 5: 114,207,326 V947M probably benign Het
Acadsb T G 7: 131,441,239 L343R probably damaging Het
Adgrf2 C T 17: 42,710,983 E317K probably damaging Het
Agap2 A G 10: 127,087,285 T663A unknown Het
Akap8 A T 17: 32,316,541 F166L possibly damaging Het
Ankrd17 A T 5: 90,242,977 M2278K probably benign Het
Avl9 T C 6: 56,728,257 S148P probably damaging Het
Brf1 T C 12: 112,970,215 E266G probably damaging Het
Cabin1 T C 10: 75,745,353 K380E probably damaging Het
Catsper2 T C 2: 121,397,063 D542G possibly damaging Het
Cbln4 C A 2: 172,042,175 D42Y probably damaging Het
Cd5 C T 19: 10,720,304 R437Q probably damaging Het
Ceacam18 G C 7: 43,639,282 E152D possibly damaging Het
Chd8 A G 14: 52,214,498 S1347P possibly damaging Het
Chodl T G 16: 78,941,447 I101R probably damaging Het
Clk4 T G 11: 51,277,932 F377L probably damaging Het
Cntnap3 C T 13: 64,781,725 probably null Het
Dab2 A G 15: 6,429,299 S231G probably benign Het
Disp2 T A 2: 118,786,880 H118Q probably benign Het
Dnah10 T C 5: 124,822,945 F3869S probably damaging Het
Edil3 C T 13: 89,131,728 T175I probably damaging Het
Fap A G 2: 62,542,178 S319P probably benign Het
Frmpd2 T A 14: 33,571,804 V1309E probably benign Het
Galntl5 T A 5: 25,189,844 S70T probably benign Het
Gm16368 T G 12: 88,083,878 I61R probably damaging Het
Gm21994 T C 2: 150,255,452 H47R probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gna15 G A 10: 81,508,047 T260M probably damaging Het
Gucy2c A G 6: 136,728,344 I531T probably damaging Het
Heatr5b A G 17: 78,827,988 V238A probably damaging Het
Htr2a A G 14: 74,705,742 Y254C probably damaging Het
Inpp5b A G 4: 124,785,272 R491G probably damaging Het
Kcnt2 C T 1: 140,596,040 L1093F possibly damaging Het
Kcp C A 6: 29,491,862 E922* probably null Het
Lrp2 G A 2: 69,465,745 A3340V possibly damaging Het
Lrrn1 T G 6: 107,568,375 V378G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Net1 G A 13: 3,888,510 R126C probably damaging Het
Nipsnap3a T C 4: 52,993,978 C20R probably benign Het
Nxpe2 C T 9: 48,320,706 C317Y probably damaging Het
Olfr1418 T A 19: 11,855,288 I222F probably damaging Het
Olfr145 T C 9: 37,898,064 I220T probably damaging Het
Olfr648 T C 7: 104,180,297 Y37C probably damaging Het
Olfr969 T G 9: 39,795,790 Y138* probably null Het
Orm1 T A 4: 63,344,712 W39R probably damaging Het
Pds5b A T 5: 150,800,677 K1240* probably null Het
Pdss1 T A 2: 22,912,669 H173Q probably damaging Het
Pebp1 A G 5: 117,285,817 W84R probably damaging Het
Pla2g16 T A 19: 7,579,185 V117E probably damaging Het
Pla2g4e C T 2: 120,171,278 C630Y probably damaging Het
Plekho2 G T 9: 65,556,353 Q405K probably benign Het
Plppr2 T A 9: 21,944,412 V227E probably damaging Het
Rapgef4 T C 2: 72,198,363 S393P probably damaging Het
Rapgefl1 A G 11: 98,847,074 probably null Het
Ripk3 C A 14: 55,788,346 R19L probably benign Het
Rnase10 G T 14: 51,009,710 V182F probably damaging Het
Rsf1 T A 7: 97,669,795 S917R Het
Sephs2 T C 7: 127,273,015 N302S possibly damaging Het
Slc13a2 C T 11: 78,399,124 V455M possibly damaging Het
Slc30a2 A T 4: 134,344,118 D54V probably benign Het
Slco6c1 T C 1: 97,119,981 E199G possibly damaging Het
Snx27 A T 3: 94,528,940 M256K probably benign Het
Spag4 T A 2: 156,066,599 S150T probably benign Het
Spon1 T A 7: 114,036,710 C720S probably damaging Het
Tbc1d9 T C 8: 83,210,484 I65T probably damaging Het
Tmem176a T A 6: 48,844,019 V141D probably damaging Het
Tmem268 G A 4: 63,562,450 probably benign Het
Tonsl A G 15: 76,634,776 V519A probably benign Het
Ttn G A 2: 76,782,032 P17204S possibly damaging Het
Wisp3 T A 10: 39,158,477 Q43L possibly damaging Het
Wrap53 T A 11: 69,563,868 D225V probably benign Het
Zfhx4 G A 3: 5,412,047 A3241T possibly damaging Het
Znfx1 T C 2: 167,056,777 R76G probably benign Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86301555 missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86391203 missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86299669 missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86239171 missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86299684 missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86292134 missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86496826 missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86351651 splice site probably null
R1703:Tbc1d22a UTSW 15 86239215 missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1925:Tbc1d22a UTSW 15 86239149 missense probably damaging 1.00
R2014:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86391065 splice site probably null
R4380:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86235685 missense probably damaging 1.00
R4690:Tbc1d22a UTSW 15 86311836 missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4883:Tbc1d22a UTSW 15 86496916 missense possibly damaging 0.91
R4920:Tbc1d22a UTSW 15 86311748 missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86391086 missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86351728 missense probably damaging 0.98
R5916:Tbc1d22a UTSW 15 86214608 missense possibly damaging 0.57
R6360:Tbc1d22a UTSW 15 86214629 missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86301567 missense possibly damaging 0.48
R7294:Tbc1d22a UTSW 15 86311835 missense possibly damaging 0.90
R7645:Tbc1d22a UTSW 15 86235541 missense probably benign 0.01
R7704:Tbc1d22a UTSW 15 86366675 missense probably damaging 1.00
RF013:Tbc1d22a UTSW 15 86299774 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTGAACAGTACTTCATTAGTGAGC -3'
(R):5'- TGGTCTTGTAAGAAACCACAACC -3'

Sequencing Primer
(F):5'- ACAGTACTTCATTAGTGAGCTAGTG -3'
(R):5'- CCACTCTCAGGGACTCACCAAG -3'
Posted On2019-05-15