Incidental Mutation 'R7139:Celsr2'
ID 553246
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms EGFL2, Adgrc2, flamingo, mfmi1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7139 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108298167-108323383 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108322675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 46 (S46G)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000090558
AA Change: S46G
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: S46G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 148,026,295 (GRCm39) R272G possibly damaging Het
4930512M02Rik T A 11: 11,540,078 (GRCm39) N179Y unknown Het
4930562C15Rik A T 16: 4,668,048 (GRCm39) M480L probably benign Het
Abcd4 A G 12: 84,653,072 (GRCm39) C377R probably benign Het
Adam23 C A 1: 63,584,736 (GRCm39) D381E probably damaging Het
Angpt1 T A 15: 42,539,747 (GRCm39) Q37H probably damaging Het
Apeh A T 9: 107,969,345 (GRCm39) F260I probably damaging Het
Cadps2 T C 6: 23,410,888 (GRCm39) Y681C probably damaging Het
Ccdc162 T C 10: 41,542,717 (GRCm39) M386V possibly damaging Het
Cfc1 T C 1: 34,575,560 (GRCm39) L78P probably benign Het
Chd7 T C 4: 8,865,865 (GRCm39) V2724A probably benign Het
Clca3a1 A T 3: 144,461,063 (GRCm39) V196E possibly damaging Het
Cma1 T C 14: 56,181,273 (GRCm39) H44R probably damaging Het
Cnot2 T C 10: 116,330,924 (GRCm39) N394S probably benign Het
Cplx3 A T 9: 57,522,879 (GRCm39) H160Q probably benign Het
Cstf3 A T 2: 104,483,409 (GRCm39) I372F possibly damaging Het
Cyb5rl A C 4: 106,928,208 (GRCm39) I115L probably benign Het
D5Ertd579e A G 5: 36,771,320 (GRCm39) L1025P probably damaging Het
Dmtn T C 14: 70,854,867 (GRCm39) N36S probably benign Het
Dnah6 A G 6: 73,112,663 (GRCm39) V1647A probably damaging Het
Dock6 T C 9: 21,712,572 (GRCm39) Y2063C probably damaging Het
Dst T A 1: 34,338,888 (GRCm39) D5149E probably damaging Het
Fancl A G 11: 26,353,358 (GRCm39) M85V probably benign Het
Fgd2 T A 17: 29,592,229 (GRCm39) F387Y probably damaging Het
Fshr A T 17: 89,293,589 (GRCm39) I363N possibly damaging Het
Glce G T 9: 61,977,716 (GRCm39) S56* probably null Het
Gm26727 A T 2: 67,263,381 (GRCm39) S49T unknown Het
Gm36210 T A 7: 4,902,277 (GRCm39) D131V probably damaging Het
Gm5089 T C 14: 122,673,403 (GRCm39) D106G unknown Het
Gm5622 G T 14: 51,893,339 (GRCm39) E89* probably null Het
H2-Eb2 C T 17: 34,553,395 (GRCm39) R194W probably benign Het
Hivep1 A T 13: 42,313,430 (GRCm39) E1890V probably benign Het
Ighv1-53 A T 12: 115,122,441 (GRCm39) C5* probably null Het
Ighv2-5 T A 12: 113,649,219 (GRCm39) Y78F probably benign Het
Il9 C T 13: 56,628,426 (GRCm39) V88I probably benign Het
Kidins220 A G 12: 25,044,820 (GRCm39) T163A probably damaging Het
Lama4 G T 10: 38,951,491 (GRCm39) D1079Y probably damaging Het
Lrrc34 T C 3: 30,679,036 (GRCm39) I354V probably benign Het
Macroh2a2 T A 10: 61,593,674 (GRCm39) M1L unknown Het
Mpeg1 A T 19: 12,439,078 (GRCm39) T179S probably benign Het
Mrgpra2a A T 7: 47,076,337 (GRCm39) L307H probably damaging Het
Mst1 G A 9: 107,960,027 (GRCm39) R328H probably damaging Het
Muc21 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,933,525 (GRCm39) probably benign Het
Nav3 C A 10: 109,689,338 (GRCm39) S313I probably benign Het
Nmt2 T G 2: 3,285,352 (GRCm39) S7A probably benign Het
Nsmce1 T C 7: 125,068,254 (GRCm39) S197G probably benign Het
Ociad2 A G 5: 73,493,218 (GRCm39) V4A probably benign Het
Or56a41 G T 7: 104,742,005 (GRCm39) T7K probably benign Het
Osmr T C 15: 6,850,569 (GRCm39) D679G possibly damaging Het
Pappa T A 4: 65,107,687 (GRCm39) F699L probably benign Het
Parp8 T A 13: 117,161,802 (GRCm39) M40L probably benign Het
Pcyox1 A T 6: 86,371,519 (GRCm39) N122K possibly damaging Het
Pkd1l1 T C 11: 8,840,737 (GRCm39) S1224G Het
Pkd1l3 T A 8: 110,362,972 (GRCm39) S1088T probably damaging Het
Prrt1 T C 17: 34,850,051 (GRCm39) V155A probably benign Het
Rbm6 A C 9: 107,730,410 (GRCm39) D79E probably damaging Het
Sec31b A T 19: 44,507,375 (GRCm39) S819T probably benign Het
Slc22a27 A T 19: 7,903,912 (GRCm39) I75N probably damaging Het
Slc25a54 G A 3: 109,005,905 (GRCm39) G138R probably damaging Het
Slc6a12 T C 6: 121,342,278 (GRCm39) S612P probably benign Het
Slc7a2 A T 8: 41,368,050 (GRCm39) I605F probably benign Het
Slit2 A G 5: 48,402,025 (GRCm39) T805A probably benign Het
Strbp A T 2: 37,514,514 (GRCm39) H308Q probably benign Het
Stxbp4 G A 11: 90,497,835 (GRCm39) Q155* probably null Het
Sybu A T 15: 44,541,110 (GRCm39) N317K possibly damaging Het
Taok1 G A 11: 77,462,459 (GRCm39) S210F probably damaging Het
Tapbp A G 17: 34,139,022 (GRCm39) D72G possibly damaging Het
Thbd G T 2: 148,248,461 (GRCm39) T469K probably benign Het
Tia1 T C 6: 86,404,670 (GRCm39) Y302H possibly damaging Het
Tlr4 T C 4: 66,758,520 (GRCm39) F438L probably benign Het
Tmem235 C T 11: 117,751,723 (GRCm39) S49L probably damaging Het
Trip4 A G 9: 65,792,503 (GRCm39) probably benign Het
Trrap C A 5: 144,739,988 (GRCm39) L1137I possibly damaging Het
Vmo1 T C 11: 70,404,674 (GRCm39) E109G probably benign Het
Wdfy4 T C 14: 32,873,535 (GRCm39) Y258C Het
Wdr91 T G 6: 34,885,198 (GRCm39) N121T possibly damaging Het
Zfp39 T C 11: 58,781,385 (GRCm39) H459R probably damaging Het
Zfp936 T A 7: 42,839,715 (GRCm39) I394K possibly damaging Het
Zpr1 G A 9: 46,192,357 (GRCm39) D423N probably damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108,321,195 (GRCm39) missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108,310,586 (GRCm39) missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108,301,079 (GRCm39) missense probably benign 0.13
IGL01448:Celsr2 APN 3 108,300,555 (GRCm39) missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108,314,183 (GRCm39) missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108,322,159 (GRCm39) missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108,301,338 (GRCm39) missense probably benign 0.00
IGL02309:Celsr2 APN 3 108,303,327 (GRCm39) missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108,320,187 (GRCm39) missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108,321,271 (GRCm39) missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108,304,826 (GRCm39) missense probably benign 0.01
IGL02812:Celsr2 APN 3 108,321,429 (GRCm39) missense probably benign 0.25
IGL02894:Celsr2 APN 3 108,302,526 (GRCm39) missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108,320,256 (GRCm39) missense probably damaging 1.00
barrow UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
goldeneye UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108,308,154 (GRCm39) missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108,319,815 (GRCm39) missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108,321,378 (GRCm39) missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108,320,718 (GRCm39) missense probably benign 0.19
R0031:Celsr2 UTSW 3 108,320,379 (GRCm39) missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0049:Celsr2 UTSW 3 108,304,570 (GRCm39) missense probably benign 0.12
R0090:Celsr2 UTSW 3 108,300,643 (GRCm39) splice site probably benign
R0140:Celsr2 UTSW 3 108,305,249 (GRCm39) missense probably benign 0.00
R0524:Celsr2 UTSW 3 108,308,903 (GRCm39) missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108,311,211 (GRCm39) critical splice donor site probably null
R0662:Celsr2 UTSW 3 108,305,836 (GRCm39) missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108,322,293 (GRCm39) missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108,319,939 (GRCm39) missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108,320,028 (GRCm39) missense probably benign 0.42
R0730:Celsr2 UTSW 3 108,305,922 (GRCm39) missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108,308,617 (GRCm39) missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108,321,654 (GRCm39) missense probably benign
R0989:Celsr2 UTSW 3 108,310,588 (GRCm39) missense probably benign 0.00
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108,307,025 (GRCm39) missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108,321,424 (GRCm39) missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108,301,055 (GRCm39) missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108,309,799 (GRCm39) missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108,320,836 (GRCm39) missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108,321,411 (GRCm39) missense probably benign
R1689:Celsr2 UTSW 3 108,314,620 (GRCm39) missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108,308,626 (GRCm39) missense probably benign 0.35
R1859:Celsr2 UTSW 3 108,303,946 (GRCm39) missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108,305,966 (GRCm39) missense probably benign 0.05
R1974:Celsr2 UTSW 3 108,321,530 (GRCm39) missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108,309,811 (GRCm39) missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108,320,509 (GRCm39) missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108,305,921 (GRCm39) missense probably benign 0.16
R2434:Celsr2 UTSW 3 108,311,795 (GRCm39) missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108,320,907 (GRCm39) missense probably benign 0.11
R3420:Celsr2 UTSW 3 108,321,732 (GRCm39) missense probably benign 0.03
R3712:Celsr2 UTSW 3 108,308,155 (GRCm39) missense probably benign
R3723:Celsr2 UTSW 3 108,304,731 (GRCm39) splice site probably benign
R3809:Celsr2 UTSW 3 108,310,555 (GRCm39) missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108,302,281 (GRCm39) missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108,309,413 (GRCm39) missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108,321,294 (GRCm39) missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108,321,088 (GRCm39) missense probably benign 0.02
R4293:Celsr2 UTSW 3 108,300,993 (GRCm39) missense probably benign 0.01
R4458:Celsr2 UTSW 3 108,302,313 (GRCm39) missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108,302,532 (GRCm39) missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108,303,285 (GRCm39) missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108,304,547 (GRCm39) missense probably benign 0.24
R4732:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108,306,268 (GRCm39) missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108,314,303 (GRCm39) missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108,310,074 (GRCm39) missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108,319,945 (GRCm39) missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108,319,674 (GRCm39) missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108,320,689 (GRCm39) missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108,301,312 (GRCm39) missense probably benign 0.05
R5120:Celsr2 UTSW 3 108,300,436 (GRCm39) missense probably benign 0.02
R5135:Celsr2 UTSW 3 108,305,975 (GRCm39) missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108,304,946 (GRCm39) missense probably benign 0.34
R5381:Celsr2 UTSW 3 108,310,073 (GRCm39) missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108,307,311 (GRCm39) missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108,299,974 (GRCm39) missense probably benign 0.01
R5528:Celsr2 UTSW 3 108,320,610 (GRCm39) missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108,310,119 (GRCm39) missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108,304,051 (GRCm39) missense probably null 0.49
R5697:Celsr2 UTSW 3 108,311,237 (GRCm39) nonsense probably null
R5718:Celsr2 UTSW 3 108,300,674 (GRCm39) missense probably benign
R5869:Celsr2 UTSW 3 108,321,225 (GRCm39) missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108,321,259 (GRCm39) missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108,308,561 (GRCm39) missense probably benign
R6054:Celsr2 UTSW 3 108,314,279 (GRCm39) missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108,300,444 (GRCm39) missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108,308,530 (GRCm39) missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108,319,890 (GRCm39) missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108,302,235 (GRCm39) missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108,307,817 (GRCm39) critical splice donor site probably null
R7062:Celsr2 UTSW 3 108,309,826 (GRCm39) missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108,305,181 (GRCm39) missense probably damaging 1.00
R7326:Celsr2 UTSW 3 108,302,311 (GRCm39) missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108,309,773 (GRCm39) missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108,320,406 (GRCm39) missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R7613:Celsr2 UTSW 3 108,302,956 (GRCm39) missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108,320,806 (GRCm39) missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108,305,904 (GRCm39) missense probably benign
R7687:Celsr2 UTSW 3 108,305,085 (GRCm39) missense probably benign 0.27
R7695:Celsr2 UTSW 3 108,310,069 (GRCm39) missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108,311,285 (GRCm39) missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108,319,971 (GRCm39) missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108,303,771 (GRCm39) missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108,320,847 (GRCm39) missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108,302,952 (GRCm39) missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108,299,949 (GRCm39) makesense probably null
R8435:Celsr2 UTSW 3 108,321,715 (GRCm39) missense probably benign
R8438:Celsr2 UTSW 3 108,301,139 (GRCm39) missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8460:Celsr2 UTSW 3 108,304,093 (GRCm39) missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108,320,167 (GRCm39) nonsense probably null
R8479:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8480:Celsr2 UTSW 3 108,306,218 (GRCm39) missense probably benign 0.00
R8512:Celsr2 UTSW 3 108,321,154 (GRCm39) missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108,314,176 (GRCm39) missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108,304,389 (GRCm39) missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108,303,443 (GRCm39) splice site probably benign
R8888:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8895:Celsr2 UTSW 3 108,320,880 (GRCm39) missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108,303,882 (GRCm39) missense probably benign 0.00
R9119:Celsr2 UTSW 3 108,309,288 (GRCm39) missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108,309,862 (GRCm39) missense probably benign 0.04
R9209:Celsr2 UTSW 3 108,321,349 (GRCm39) missense probably benign 0.02
R9342:Celsr2 UTSW 3 108,320,442 (GRCm39) missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108,322,084 (GRCm39) missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108,301,074 (GRCm39) missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108,321,834 (GRCm39) missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108,322,578 (GRCm39) missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108,308,915 (GRCm39) missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108,301,551 (GRCm39) missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108,303,426 (GRCm39) missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108,308,588 (GRCm39) missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108,321,433 (GRCm39) missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108,319,657 (GRCm39) missense probably benign 0.07
Z1176:Celsr2 UTSW 3 108,300,447 (GRCm39) missense probably benign 0.10
Z1177:Celsr2 UTSW 3 108,320,887 (GRCm39) missense probably benign 0.32
Z1177:Celsr2 UTSW 3 108,319,536 (GRCm39) missense probably damaging 1.00
Z1191:Celsr2 UTSW 3 108,321,865 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCCGATACCCAGGAGACGAC -3'
(R):5'- CGCAGGTAGAGAACGCTCAG -3'

Sequencing Primer
(F):5'- CAGGAGACGACAGCTCCAG -3'
(R):5'- GCATCGTGGGCTAAGAGC -3'
Posted On 2019-05-15