Incidental Mutation 'R7139:D5Ertd579e'
ID553254
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R7139 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36613976 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1025 (L1025P)
Ref Sequence ENSEMBL: ENSMUSP00000031091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect probably damaging
Transcript: ENSMUST00000031091
AA Change: L1025P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: L1025P

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,941,838 R272G possibly damaging Het
4930512M02Rik T A 11: 11,590,078 N179Y unknown Het
4930562C15Rik A T 16: 4,850,184 M480L probably benign Het
Abcd4 A G 12: 84,606,298 C377R probably benign Het
Adam23 C A 1: 63,545,577 D381E probably damaging Het
Angpt1 T A 15: 42,676,351 Q37H probably damaging Het
Apeh A T 9: 108,092,146 F260I probably damaging Het
Cadps2 T C 6: 23,410,889 Y681C probably damaging Het
Ccdc162 T C 10: 41,666,721 M386V possibly damaging Het
Celsr2 T C 3: 108,415,359 S46G unknown Het
Cfc1 T C 1: 34,536,479 L78P probably benign Het
Chd7 T C 4: 8,865,865 V2724A probably benign Het
Clca3a1 A T 3: 144,755,302 V196E possibly damaging Het
Cma1 T C 14: 55,943,816 H44R probably damaging Het
Cnot2 T C 10: 116,495,019 N394S probably benign Het
Cstf3 A T 2: 104,653,064 I372F possibly damaging Het
Cyb5rl A C 4: 107,071,011 I115L probably benign Het
Dmtn T C 14: 70,617,427 N36S probably benign Het
Dnah6 A G 6: 73,135,680 V1647A probably damaging Het
Dock6 T C 9: 21,801,276 Y2063C probably damaging Het
Dst T A 1: 34,299,807 D5149E probably damaging Het
Fancl A G 11: 26,403,358 M85V probably benign Het
Fgd2 T A 17: 29,373,255 F387Y probably damaging Het
Fshr A T 17: 88,986,161 I363N possibly damaging Het
Glce G T 9: 62,070,434 S56* probably null Het
Gm26727 A T 2: 67,433,037 S49T unknown Het
Gm36210 T A 7: 4,899,278 D131V probably damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2afy2 T A 10: 61,757,895 M1L unknown Het
H2-Eb2 C T 17: 34,334,421 R194W probably benign Het
Hivep1 A T 13: 42,159,954 E1890V probably benign Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Ighv2-5 T A 12: 113,685,599 Y78F probably benign Het
Il9 C T 13: 56,480,613 V88I probably benign Het
Kidins220 A G 12: 24,994,821 T163A probably damaging Het
Lama4 G T 10: 39,075,495 D1079Y probably damaging Het
Lman1l A T 9: 57,615,596 H160Q probably benign Het
Lrrc34 T C 3: 30,624,887 I354V probably benign Het
Mpeg1 A T 19: 12,461,714 T179S probably benign Het
Mrgpra2a A T 7: 47,426,589 L307H probably damaging Het
Mst1 G A 9: 108,082,828 R328H probably damaging Het
Nav3 C A 10: 109,853,477 S313I probably benign Het
Nmt2 T G 2: 3,284,315 S7A probably benign Het
Nsmce1 T C 7: 125,469,082 S197G probably benign Het
Ociad2 A G 5: 73,335,875 V4A probably benign Het
Olfr680-ps1 G T 7: 105,092,798 T7K probably benign Het
Osmr T C 15: 6,821,088 D679G possibly damaging Het
Pappa T A 4: 65,189,450 F699L probably benign Het
Parp8 T A 13: 117,025,266 M40L probably benign Het
Pcyox1 A T 6: 86,394,537 N122K possibly damaging Het
Pkd1l1 T C 11: 8,890,737 S1224G Het
Pkd1l3 T A 8: 109,636,340 S1088T probably damaging Het
Prrt1 T C 17: 34,631,077 V155A probably benign Het
Rbm6 A C 9: 107,853,211 D79E probably damaging Het
Sec31b A T 19: 44,518,936 S819T probably benign Het
Slc22a27 A T 19: 7,926,547 I75N probably damaging Het
Slc25a54 G A 3: 109,098,589 G138R probably damaging Het
Slc6a12 T C 6: 121,365,319 S612P probably benign Het
Slc7a2 A T 8: 40,915,013 I605F probably benign Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Strbp A T 2: 37,624,502 H308Q probably benign Het
Stxbp4 G A 11: 90,607,009 Q155* probably null Het
Sybu A T 15: 44,677,714 N317K possibly damaging Het
Taok1 G A 11: 77,571,633 S210F probably damaging Het
Tapbp A G 17: 33,920,048 D72G possibly damaging Het
Thbd G T 2: 148,406,541 T469K probably benign Het
Tia1 T C 6: 86,427,688 Y302H possibly damaging Het
Tlr4 T C 4: 66,840,283 F438L probably benign Het
Tmem235 C T 11: 117,860,897 S49L probably damaging Het
Trip4 A G 9: 65,885,221 probably benign Het
Trrap C A 5: 144,803,178 L1137I possibly damaging Het
Vmo1 T C 11: 70,513,848 E109G probably benign Het
Wdfy4 T C 14: 33,151,578 Y258C Het
Wdr91 T G 6: 34,908,263 N121T possibly damaging Het
Zfp39 T C 11: 58,890,559 H459R probably damaging Het
Zfp936 T A 7: 43,190,291 I394K possibly damaging Het
Zpr1 G A 9: 46,281,059 D423N probably damaging Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 splice site probably null
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R7951:D5Ertd579e UTSW 5 36615173 missense probably benign
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8281:D5Ertd579e UTSW 5 36613320 missense
R8398:D5Ertd579e UTSW 5 36614277 nonsense probably null
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTCACTGTCTGAATCAGAGC -3'
(R):5'- CTGGTCACACAAAAGGGAGC -3'

Sequencing Primer
(F):5'- CTCACTGTCTGAATCAGAGCAGAGG -3'
(R):5'- CTACAGTGTGCAGCCTCTGATG -3'
Posted On2019-05-15