Mutagenetix > Incidental Mutation

Incidental Mutation 'R0600:Sorl1'

55326

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

038789-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R0600 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 42043900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably benign
Transcript: ENSMUST00000060989

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.5%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,357,660	S150P	probably damaging	Het
4932431P20Rik	T	A	7: 29,533,265		noncoding transcript	Het
5530400C23Rik	T	G	6: 133,293,211		probably benign	Het
Ahctf1	A	C	1: 179,763,468		probably null	Het
Ang5	T	C	14: 43,962,749	V90A	probably benign	Het
Ano9	C	T	7: 141,104,710	G442R	probably damaging	Het
Apaf1	G	A	10: 91,060,052	T386I	probably damaging	Het
Apob	C	A	12: 8,006,440	H1608N	probably damaging	Het
Arhgap12	C	A	18: 6,064,433		probably benign	Het
Asxl1	T	A	2: 153,399,904	D791E	probably benign	Het
Avl9	T	C	6: 56,736,906	V383A	probably benign	Het
Btbd1	A	C	7: 81,816,006	D197E	probably damaging	Het
C87499	A	T	4: 88,629,299	I45K	probably damaging	Het
Camta2	T	C	11: 70,673,959	I938V	possibly damaging	Het
Cdca7	C	A	2: 72,483,467	A200D	possibly damaging	Het
Cep104	A	T	4: 154,006,792	Y923F	possibly damaging	Het
Cep135	G	C	5: 76,621,305	V601L	probably benign	Het
Ces2b	G	A	8: 104,835,910	G291S	probably benign	Het
Col6a6	C	T	9: 105,761,440	G1400D	probably damaging	Het
Cyth2	T	C	7: 45,813,117	E1G	probably damaging	Het
Dand5	A	T	8: 84,816,292	L185Q	probably damaging	Het
Dck	T	C	5: 88,781,221	V253A	probably benign	Het
Ddx20	A	G	3: 105,679,080	S650P	probably damaging	Het
Dicer1	G	A	12: 104,706,864	P799S	probably damaging	Het
Dst	C	T	1: 34,189,119	P1606L	probably damaging	Het
Eya2	G	A	2: 165,769,237	C477Y	probably damaging	Het
Fam208b	A	T	13: 3,576,054	F1299I	probably benign	Het
Fip1l1	T	A	5: 74,595,842	N498K	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Galntl6	T	C	8: 57,837,183		probably null	Het
Gda	A	T	19: 21,434,303	F44I	possibly damaging	Het
Gli2	G	A	1: 118,840,389	R703C	probably damaging	Het
Gm14085	A	T	2: 122,514,398	I162F	probably damaging	Het
Golgb1	T	A	16: 36,916,271	L1960Q	probably damaging	Het
Gramd1b	T	C	9: 40,308,355	D341G	probably damaging	Het
Grid2	G	T	6: 63,503,435	A78S	probably benign	Het
Hao2	A	T	3: 98,883,560		probably benign	Het
Hook3	A	G	8: 26,118,986	V10A	probably benign	Het
Kif20a	A	G	18: 34,629,209	E425G	probably damaging	Het
Lrp1	T	C	10: 127,567,383	D2107G	probably benign	Het
Lrriq3	T	C	3: 155,187,736	I358T	possibly damaging	Het
Mad2l2	A	G	4: 148,140,924	D17G	possibly damaging	Het
Mastl	G	T	2: 23,133,346	T455K	probably benign	Het
Mkln1	G	T	6: 31,432,927		probably benign	Het
Mmp1b	A	T	9: 7,387,947	Y16N	possibly damaging	Het
Mmp24	C	T	2: 155,792,597	A79V	probably benign	Het
Mrps35	T	A	6: 147,070,734	C292S	possibly damaging	Het
Myom1	T	C	17: 71,120,648	F1435L	possibly damaging	Het
Nars2	C	T	7: 97,039,923	H351Y	probably damaging	Het
Nat2	A	T	8: 67,501,267	I10F	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm5	A	T	7: 104,153,869	Y462*	probably null	Het
Olfr1228	C	A	2: 89,249,398	E87*	probably null	Het
Olfr1339	C	T	4: 118,734,789	H87Y	probably damaging	Het
Olfr1508	T	C	14: 52,463,509	I167V	probably benign	Het
Olfr322	C	A	11: 58,666,160	F200L	probably damaging	Het
Olfr340	C	A	2: 36,452,648	A21E	probably benign	Het
Olfr44	A	T	9: 39,484,988	F85L	probably benign	Het
Olfr495	T	A	7: 108,395,231	I37N	probably damaging	Het
Olfr855	T	C	9: 19,585,304	S256P	possibly damaging	Het
Olfr926	T	A	9: 38,877,815	I213N	probably damaging	Het
Otog	A	T	7: 46,251,395		probably benign	Het
Pdcd2l	A	T	7: 34,192,807	D212E	possibly damaging	Het
Pex5	T	C	6: 124,404,637	N213S	probably benign	Het
Pkn3	C	T	2: 30,081,134	P238S	probably benign	Het
Prl2b1	A	T	13: 27,390,740		probably null	Het
Ptprb	A	T	10: 116,368,807	I1849L	possibly damaging	Het
Rasal3	G	T	17: 32,393,526	S787Y	probably damaging	Het
Scn2a	T	A	2: 65,701,833	D596E	possibly damaging	Het
Sdhd	A	T	9: 50,603,764	V9D	possibly damaging	Het
Serinc5	T	C	13: 92,708,057	S436P	probably damaging	Het
Slc27a1	C	T	8: 71,584,164	P348L	probably damaging	Het
Smg1	G	A	7: 118,160,383		probably benign	Het
Sprtn	T	A	8: 124,900,218	H112Q	probably damaging	Het
Tet2	A	G	3: 133,467,602	M1633T	probably benign	Het
Tet2	T	A	3: 133,467,725	D1592V	probably benign	Het
Tmem68	A	T	4: 3,569,667	C8S	probably damaging	Het
Tnrc6a	T	A	7: 123,171,816	I943N	probably benign	Het
Trib2	A	T	12: 15,794,068	V191D	probably damaging	Het
Tsc22d4	T	C	5: 137,762,655	S113P	probably damaging	Het
Ttc21b	T	C	2: 66,239,570	R250G	probably damaging	Het
Ubr2	T	C	17: 46,967,248	Y721C	probably damaging	Het
Ubtfl1	A	T	9: 18,409,364	I63F	probably damaging	Het
Ush1c	G	A	7: 46,224,908	P171S	probably benign	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vangl1	A	G	3: 102,166,937	Y285H	probably damaging	Het
Virma	A	G	4: 11,498,769	D70G	probably damaging	Het
Vmn2r102	T	C	17: 19,678,015	F431L	probably benign	Het
Wdr17	A	G	8: 54,661,495	I662T	probably damaging	Het
Wisp2	G	A	2: 163,825,313	C78Y	probably damaging	Het
Zfp160	G	A	17: 21,027,006	R606H	probably benign	Het
Zfp369	C	T	13: 65,296,434	R464C	probably damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTCTGCTGAACTTCATGGCTAGACC -3'
(R):5'- CTGGATCTGATACATTGCTCTGCCC -3'

Sequencing Primer
(F):5'- CTTCATGGCTAGACCTAGAAGATGAC -3'
(R):5'- GGTTCCTTGCACAGAAAACG -3'

Posted On

2013-07-11