Incidental Mutation 'R7139:Pkd1l1'
ID553284
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7139 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8890737 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1224 (S1224G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: S1224G

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178195
AA Change: S774G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: S774G

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,941,838 R272G possibly damaging Het
4930512M02Rik T A 11: 11,590,078 N179Y unknown Het
4930562C15Rik A T 16: 4,850,184 M480L probably benign Het
Abcd4 A G 12: 84,606,298 C377R probably benign Het
Adam23 C A 1: 63,545,577 D381E probably damaging Het
Angpt1 T A 15: 42,676,351 Q37H probably damaging Het
Apeh A T 9: 108,092,146 F260I probably damaging Het
Cadps2 T C 6: 23,410,889 Y681C probably damaging Het
Ccdc162 T C 10: 41,666,721 M386V possibly damaging Het
Celsr2 T C 3: 108,415,359 S46G unknown Het
Cfc1 T C 1: 34,536,479 L78P probably benign Het
Chd7 T C 4: 8,865,865 V2724A probably benign Het
Clca3a1 A T 3: 144,755,302 V196E possibly damaging Het
Cma1 T C 14: 55,943,816 H44R probably damaging Het
Cnot2 T C 10: 116,495,019 N394S probably benign Het
Cstf3 A T 2: 104,653,064 I372F possibly damaging Het
Cyb5rl A C 4: 107,071,011 I115L probably benign Het
D5Ertd579e A G 5: 36,613,976 L1025P probably damaging Het
Dmtn T C 14: 70,617,427 N36S probably benign Het
Dnah6 A G 6: 73,135,680 V1647A probably damaging Het
Dock6 T C 9: 21,801,276 Y2063C probably damaging Het
Dst T A 1: 34,299,807 D5149E probably damaging Het
Fancl A G 11: 26,403,358 M85V probably benign Het
Fgd2 T A 17: 29,373,255 F387Y probably damaging Het
Fshr A T 17: 88,986,161 I363N possibly damaging Het
Glce G T 9: 62,070,434 S56* probably null Het
Gm26727 A T 2: 67,433,037 S49T unknown Het
Gm36210 T A 7: 4,899,278 D131V probably damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2afy2 T A 10: 61,757,895 M1L unknown Het
H2-Eb2 C T 17: 34,334,421 R194W probably benign Het
Hivep1 A T 13: 42,159,954 E1890V probably benign Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Ighv2-5 T A 12: 113,685,599 Y78F probably benign Het
Il9 C T 13: 56,480,613 V88I probably benign Het
Kidins220 A G 12: 24,994,821 T163A probably damaging Het
Lama4 G T 10: 39,075,495 D1079Y probably damaging Het
Lman1l A T 9: 57,615,596 H160Q probably benign Het
Lrrc34 T C 3: 30,624,887 I354V probably benign Het
Mpeg1 A T 19: 12,461,714 T179S probably benign Het
Mrgpra2a A T 7: 47,426,589 L307H probably damaging Het
Mst1 G A 9: 108,082,828 R328H probably damaging Het
Nav3 C A 10: 109,853,477 S313I probably benign Het
Nmt2 T G 2: 3,284,315 S7A probably benign Het
Nsmce1 T C 7: 125,469,082 S197G probably benign Het
Ociad2 A G 5: 73,335,875 V4A probably benign Het
Olfr680-ps1 G T 7: 105,092,798 T7K probably benign Het
Osmr T C 15: 6,821,088 D679G possibly damaging Het
Pappa T A 4: 65,189,450 F699L probably benign Het
Parp8 T A 13: 117,025,266 M40L probably benign Het
Pcyox1 A T 6: 86,394,537 N122K possibly damaging Het
Pkd1l3 T A 8: 109,636,340 S1088T probably damaging Het
Prrt1 T C 17: 34,631,077 V155A probably benign Het
Rbm6 A C 9: 107,853,211 D79E probably damaging Het
Sec31b A T 19: 44,518,936 S819T probably benign Het
Slc22a27 A T 19: 7,926,547 I75N probably damaging Het
Slc25a54 G A 3: 109,098,589 G138R probably damaging Het
Slc6a12 T C 6: 121,365,319 S612P probably benign Het
Slc7a2 A T 8: 40,915,013 I605F probably benign Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Strbp A T 2: 37,624,502 H308Q probably benign Het
Stxbp4 G A 11: 90,607,009 Q155* probably null Het
Sybu A T 15: 44,677,714 N317K possibly damaging Het
Taok1 G A 11: 77,571,633 S210F probably damaging Het
Tapbp A G 17: 33,920,048 D72G possibly damaging Het
Thbd G T 2: 148,406,541 T469K probably benign Het
Tia1 T C 6: 86,427,688 Y302H possibly damaging Het
Tlr4 T C 4: 66,840,283 F438L probably benign Het
Tmem235 C T 11: 117,860,897 S49L probably damaging Het
Trip4 A G 9: 65,885,221 probably benign Het
Trrap C A 5: 144,803,178 L1137I possibly damaging Het
Vmo1 T C 11: 70,513,848 E109G probably benign Het
Wdfy4 T C 14: 33,151,578 Y258C Het
Wdr91 T G 6: 34,908,263 N121T possibly damaging Het
Zfp39 T C 11: 58,890,559 H459R probably damaging Het
Zfp936 T A 7: 43,190,291 I394K possibly damaging Het
Zpr1 G A 9: 46,281,059 D423N probably damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7485:Pkd1l1 UTSW 11 8965148 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTGCTGTCATTGGAGAGAAAAC -3'
(R):5'- CTACTATTTGGGTATGGAGCCC -3'

Sequencing Primer
(F):5'- TGCTGTCATTGGAGAGAAAACAAGTC -3'
(R):5'- TCTGCTACAAATGGAAAAGGAAACTG -3'
Posted On2019-05-15