Mutagenetix > Incidental Mutations

Incidental Mutation 'R0600:Apaf1'

55329

Institutional Source

Beutler Lab

Gene Symbol

Apaf1

Ensembl Gene

ENSMUSG00000019979

Gene Name

apoptotic peptidase activating factor 1

Synonyms

Apaf1l, 6230400I06Rik

MMRRC Submission

038789-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0600 (G1)

Quality Score

134

Status

Validated

Chromosome

Chromosomal Location

90989311-91082770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 91060052 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 386 (T386I)

Ref Sequence

ENSEMBL: ENSMUSP00000124134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020157
AA Change: T397I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: T397I

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.3e-22	PFAM
Pfam:NB-ARC	129	414	1.7e-77	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159110
AA Change: T397I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: T397I

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.4e-21	PFAM
Pfam:NB-ARC	129	414	6.9e-71	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000162618
AA Change: T386I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: T386I

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1.1e-20	PFAM
Pfam:NB-ARC	118	403	8.8e-72	PFAM
WD40	593	632	1.35e-5	SMART
WD40	635	674	1.04e-11	SMART
WD40	677	718	2.98e-7	SMART
WD40	721	760	9.88e-13	SMART
WD40	769	814	1.28e1	SMART
WD40	817	857	1.43e0	SMART
WD40	860	899	3.24e-8	SMART
WD40	941	978	2.57e0	SMART
WD40	981	1020	1.09e-5	SMART
WD40	1022	1060	2.09e-2	SMART
WD40	1063	1102	2.93e-6	SMART
WD40	1105	1144	8.55e-8	SMART
WD40	1157	1193	4.55e-3	SMART
Blast:WD40	1196	1235	5e-18	BLAST

Meta Mutation Damage Score

0.7338

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.5%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,357,660	S150P	probably damaging	Het
4932431P20Rik	T	A	7: 29,533,265		noncoding transcript	Het
5530400C23Rik	T	G	6: 133,293,211		probably benign	Het
Ahctf1	A	C	1: 179,763,468		probably null	Het
Ang5	T	C	14: 43,962,749	V90A	probably benign	Het
Ano9	C	T	7: 141,104,710	G442R	probably damaging	Het
Apob	C	A	12: 8,006,440	H1608N	probably damaging	Het
Arhgap12	C	A	18: 6,064,433		probably benign	Het
Asxl1	T	A	2: 153,399,904	D791E	probably benign	Het
Avl9	T	C	6: 56,736,906	V383A	probably benign	Het
Btbd1	A	C	7: 81,816,006	D197E	probably damaging	Het
C87499	A	T	4: 88,629,299	I45K	probably damaging	Het
Camta2	T	C	11: 70,673,959	I938V	possibly damaging	Het
Cdca7	C	A	2: 72,483,467	A200D	possibly damaging	Het
Cep104	A	T	4: 154,006,792	Y923F	possibly damaging	Het
Cep135	G	C	5: 76,621,305	V601L	probably benign	Het
Ces2b	G	A	8: 104,835,910	G291S	probably benign	Het
Col6a6	C	T	9: 105,761,440	G1400D	probably damaging	Het
Cyth2	T	C	7: 45,813,117	E1G	probably damaging	Het
Dand5	A	T	8: 84,816,292	L185Q	probably damaging	Het
Dck	T	C	5: 88,781,221	V253A	probably benign	Het
Ddx20	A	G	3: 105,679,080	S650P	probably damaging	Het
Dicer1	G	A	12: 104,706,864	P799S	probably damaging	Het
Dst	C	T	1: 34,189,119	P1606L	probably damaging	Het
Eya2	G	A	2: 165,769,237	C477Y	probably damaging	Het
Fam208b	A	T	13: 3,576,054	F1299I	probably benign	Het
Fip1l1	T	A	5: 74,595,842	N498K	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Galntl6	T	C	8: 57,837,183		probably null	Het
Gda	A	T	19: 21,434,303	F44I	possibly damaging	Het
Gli2	G	A	1: 118,840,389	R703C	probably damaging	Het
Gm14085	A	T	2: 122,514,398	I162F	probably damaging	Het
Golgb1	T	A	16: 36,916,271	L1960Q	probably damaging	Het
Gramd1b	T	C	9: 40,308,355	D341G	probably damaging	Het
Grid2	G	T	6: 63,503,435	A78S	probably benign	Het
Hao2	A	T	3: 98,883,560		probably benign	Het
Hook3	A	G	8: 26,118,986	V10A	probably benign	Het
Kif20a	A	G	18: 34,629,209	E425G	probably damaging	Het
Lrp1	T	C	10: 127,567,383	D2107G	probably benign	Het
Lrriq3	T	C	3: 155,187,736	I358T	possibly damaging	Het
Mad2l2	A	G	4: 148,140,924	D17G	possibly damaging	Het
Mastl	G	T	2: 23,133,346	T455K	probably benign	Het
Mkln1	G	T	6: 31,432,927		probably benign	Het
Mmp1b	A	T	9: 7,387,947	Y16N	possibly damaging	Het
Mmp24	C	T	2: 155,792,597	A79V	probably benign	Het
Mrps35	T	A	6: 147,070,734	C292S	possibly damaging	Het
Myom1	T	C	17: 71,120,648	F1435L	possibly damaging	Het
Nars2	C	T	7: 97,039,923	H351Y	probably damaging	Het
Nat2	A	T	8: 67,501,267	I10F	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm5	A	T	7: 104,153,869	Y462*	probably null	Het
Olfr1228	C	A	2: 89,249,398	E87*	probably null	Het
Olfr1339	C	T	4: 118,734,789	H87Y	probably damaging	Het
Olfr1508	T	C	14: 52,463,509	I167V	probably benign	Het
Olfr322	C	A	11: 58,666,160	F200L	probably damaging	Het
Olfr340	C	A	2: 36,452,648	A21E	probably benign	Het
Olfr44	A	T	9: 39,484,988	F85L	probably benign	Het
Olfr495	T	A	7: 108,395,231	I37N	probably damaging	Het
Olfr855	T	C	9: 19,585,304	S256P	possibly damaging	Het
Olfr926	T	A	9: 38,877,815	I213N	probably damaging	Het
Otog	A	T	7: 46,251,395		probably benign	Het
Pdcd2l	A	T	7: 34,192,807	D212E	possibly damaging	Het
Pex5	T	C	6: 124,404,637	N213S	probably benign	Het
Pkn3	C	T	2: 30,081,134	P238S	probably benign	Het
Prl2b1	A	T	13: 27,390,740		probably null	Het
Ptprb	A	T	10: 116,368,807	I1849L	possibly damaging	Het
Rasal3	G	T	17: 32,393,526	S787Y	probably damaging	Het
Scn2a	T	A	2: 65,701,833	D596E	possibly damaging	Het
Sdhd	A	T	9: 50,603,764	V9D	possibly damaging	Het
Serinc5	T	C	13: 92,708,057	S436P	probably damaging	Het
Slc27a1	C	T	8: 71,584,164	P348L	probably damaging	Het
Smg1	G	A	7: 118,160,383		probably benign	Het
Sorl1	A	T	9: 42,043,900		probably benign	Het
Sprtn	T	A	8: 124,900,218	H112Q	probably damaging	Het
Tet2	A	G	3: 133,467,602	M1633T	probably benign	Het
Tet2	T	A	3: 133,467,725	D1592V	probably benign	Het
Tmem68	A	T	4: 3,569,667	C8S	probably damaging	Het
Tnrc6a	T	A	7: 123,171,816	I943N	probably benign	Het
Trib2	A	T	12: 15,794,068	V191D	probably damaging	Het
Tsc22d4	T	C	5: 137,762,655	S113P	probably damaging	Het
Ttc21b	T	C	2: 66,239,570	R250G	probably damaging	Het
Ubr2	T	C	17: 46,967,248	Y721C	probably damaging	Het
Ubtfl1	A	T	9: 18,409,364	I63F	probably damaging	Het
Ush1c	G	A	7: 46,224,908	P171S	probably benign	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vangl1	A	G	3: 102,166,937	Y285H	probably damaging	Het
Virma	A	G	4: 11,498,769	D70G	probably damaging	Het
Vmn2r102	T	C	17: 19,678,015	F431L	probably benign	Het
Wdr17	A	G	8: 54,661,495	I662T	probably damaging	Het
Wisp2	G	A	2: 163,825,313	C78Y	probably damaging	Het
Zfp160	G	A	17: 21,027,006	R606H	probably benign	Het
Zfp369	C	T	13: 65,296,434	R464C	probably damaging	Het

Other mutations in Apaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Apaf1	APN	10	91023788	missense	probably damaging	0.99
IGL00819:Apaf1	APN	10	90997340	splice site	probably null
IGL01481:Apaf1	APN	10	91031588	missense	possibly damaging	0.84
IGL01713:Apaf1	APN	10	91061832	splice site	probably benign
IGL01715:Apaf1	APN	10	91058354	missense	probably benign	0.20
IGL02152:Apaf1	APN	10	91061819	missense	probably benign	0.24
IGL02331:Apaf1	APN	10	91059619	missense	probably damaging	1.00
IGL03071:Apaf1	APN	10	90997255	missense	possibly damaging	0.88
IGL03101:Apaf1	APN	10	91031559	missense	possibly damaging	0.89
IGL03244:Apaf1	APN	10	91049349	splice site	probably benign
Mayhem	UTSW	10	90999719	missense	probably damaging	0.99
Wipeout	UTSW	10	91056000	missense	probably damaging	1.00
R0520:Apaf1	UTSW	10	91079989	missense	probably damaging	0.99
R0607:Apaf1	UTSW	10	91009203	missense	probably damaging	1.00
R0688:Apaf1	UTSW	10	91061705	missense	possibly damaging	0.94
R0734:Apaf1	UTSW	10	91037021	missense	probably benign	0.02
R1256:Apaf1	UTSW	10	91058406	missense	probably benign
R1459:Apaf1	UTSW	10	91062160	missense	probably benign	0.00
R1485:Apaf1	UTSW	10	91060243	missense	probably benign	0.02
R1511:Apaf1	UTSW	10	91060185	missense	possibly damaging	0.81
R1531:Apaf1	UTSW	10	91054521	missense	probably damaging	1.00
R1705:Apaf1	UTSW	10	91067271	splice site	probably benign
R1919:Apaf1	UTSW	10	91077614	nonsense	probably null
R1925:Apaf1	UTSW	10	90999719	missense	probably damaging	0.99
R2001:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2002:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2006:Apaf1	UTSW	10	91061772	missense	probably damaging	1.00
R2043:Apaf1	UTSW	10	91037028	missense	probably damaging	1.00
R2073:Apaf1	UTSW	10	91031694	nonsense	probably null
R2101:Apaf1	UTSW	10	91060080	missense	probably benign	0.26
R2130:Apaf1	UTSW	10	91060165	nonsense	probably null
R2153:Apaf1	UTSW	10	91048090	missense	probably damaging	1.00
R2377:Apaf1	UTSW	10	91079893	missense	possibly damaging	0.95
R2421:Apaf1	UTSW	10	91020723	missense	probably damaging	1.00
R3835:Apaf1	UTSW	10	91059587	missense	probably benign	0.07
R4750:Apaf1	UTSW	10	91060188	missense	probably damaging	1.00
R5100:Apaf1	UTSW	10	90997287	missense	probably benign
R5135:Apaf1	UTSW	10	91060094	missense	probably damaging	1.00
R5497:Apaf1	UTSW	10	90999656	missense	probably damaging	1.00
R5511:Apaf1	UTSW	10	91054392	missense	probably damaging	1.00
R5659:Apaf1	UTSW	10	91062153	nonsense	probably null
R5730:Apaf1	UTSW	10	91020771	missense	possibly damaging	0.62
R6176:Apaf1	UTSW	10	91059571	critical splice donor site	probably null
R6242:Apaf1	UTSW	10	91062163	missense	probably damaging	1.00
R6292:Apaf1	UTSW	10	90991563	missense	possibly damaging	0.86
R6376:Apaf1	UTSW	10	91023811	missense	probably damaging	1.00
R6534:Apaf1	UTSW	10	91056000	missense	probably damaging	1.00
R6975:Apaf1	UTSW	10	91020734	missense	probably damaging	0.97
R7218:Apaf1	UTSW	10	91037002	missense	probably damaging	1.00
R7369:Apaf1	UTSW	10	91001036	missense	probably damaging	0.97
R7409:Apaf1	UTSW	10	91067246	missense	probably damaging	1.00
R7413:Apaf1	UTSW	10	90995680	missense	probably benign	0.28
R7418:Apaf1	UTSW	10	91023835	missense	probably benign	0.09
R7423:Apaf1	UTSW	10	91059606	missense	probably damaging	1.00
R7488:Apaf1	UTSW	10	91054380	missense	probably benign	0.35
R7765:Apaf1	UTSW	10	91023782	missense	probably benign	0.34
R7913:Apaf1	UTSW	10	91060271	missense	probably damaging	0.99
R7914:Apaf1	UTSW	10	91060233	missense	probably damaging	1.00
R7922:Apaf1	UTSW	10	90999753	missense	probably benign
R8131:Apaf1	UTSW	10	91077558	missense	possibly damaging	0.93
R8158:Apaf1	UTSW	10	91059658	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGGCATTTCAGTACCTGAAGCTGAC -3'
(R):5'- ATCGCTGGGCATACTACCTCAGAC -3'

Sequencing Primer
(F):5'- TGAAAAACCGGGTGCTTCTC -3'
(R):5'- GGCATACTACCTCAGACAGCTTC -3'

Posted On

2013-07-11