Incidental Mutation 'R7139:Dmtn'
ID553302
Institutional Source Beutler Lab
Gene Symbol Dmtn
Ensembl Gene ENSMUSG00000022099
Gene Namedematin actin binding protein
SynonymsEpb4.9, dematin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R7139 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70601263-70636048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70617427 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 36 (N36S)
Ref Sequence ENSEMBL: ENSMUSP00000022694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000226543] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228009] [ENSMUST00000228295] [ENSMUST00000228824]
Predicted Effect probably benign
Transcript: ENSMUST00000022694
AA Change: N36S

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: N36S

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 8 93 8e-30 PFAM
Pfam:AbLIM_anchor 79 347 1.9e-58 PFAM
VHP 348 383 1.88e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022695
AA Change: N11S

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099
AA Change: N11S

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
coiled coil region 188 220 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
VHP 345 380 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110984
AA Change: N36S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: N36S

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 213 245 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
VHP 348 383 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226543
Predicted Effect probably benign
Transcript: ENSMUST00000227331
Predicted Effect probably damaging
Transcript: ENSMUST00000228001
AA Change: N11S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000228009
AA Change: N36S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228295
AA Change: N11S

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000228824
AA Change: N11S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,941,838 R272G possibly damaging Het
4930512M02Rik T A 11: 11,590,078 N179Y unknown Het
4930562C15Rik A T 16: 4,850,184 M480L probably benign Het
Abcd4 A G 12: 84,606,298 C377R probably benign Het
Adam23 C A 1: 63,545,577 D381E probably damaging Het
Angpt1 T A 15: 42,676,351 Q37H probably damaging Het
Apeh A T 9: 108,092,146 F260I probably damaging Het
Cadps2 T C 6: 23,410,889 Y681C probably damaging Het
Ccdc162 T C 10: 41,666,721 M386V possibly damaging Het
Celsr2 T C 3: 108,415,359 S46G unknown Het
Cfc1 T C 1: 34,536,479 L78P probably benign Het
Chd7 T C 4: 8,865,865 V2724A probably benign Het
Clca3a1 A T 3: 144,755,302 V196E possibly damaging Het
Cma1 T C 14: 55,943,816 H44R probably damaging Het
Cnot2 T C 10: 116,495,019 N394S probably benign Het
Cstf3 A T 2: 104,653,064 I372F possibly damaging Het
Cyb5rl A C 4: 107,071,011 I115L probably benign Het
D5Ertd579e A G 5: 36,613,976 L1025P probably damaging Het
Dnah6 A G 6: 73,135,680 V1647A probably damaging Het
Dock6 T C 9: 21,801,276 Y2063C probably damaging Het
Dst T A 1: 34,299,807 D5149E probably damaging Het
Fancl A G 11: 26,403,358 M85V probably benign Het
Fgd2 T A 17: 29,373,255 F387Y probably damaging Het
Fshr A T 17: 88,986,161 I363N possibly damaging Het
Glce G T 9: 62,070,434 S56* probably null Het
Gm26727 A T 2: 67,433,037 S49T unknown Het
Gm36210 T A 7: 4,899,278 D131V probably damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2afy2 T A 10: 61,757,895 M1L unknown Het
H2-Eb2 C T 17: 34,334,421 R194W probably benign Het
Hivep1 A T 13: 42,159,954 E1890V probably benign Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Ighv2-5 T A 12: 113,685,599 Y78F probably benign Het
Il9 C T 13: 56,480,613 V88I probably benign Het
Kidins220 A G 12: 24,994,821 T163A probably damaging Het
Lama4 G T 10: 39,075,495 D1079Y probably damaging Het
Lman1l A T 9: 57,615,596 H160Q probably benign Het
Lrrc34 T C 3: 30,624,887 I354V probably benign Het
Mpeg1 A T 19: 12,461,714 T179S probably benign Het
Mrgpra2a A T 7: 47,426,589 L307H probably damaging Het
Mst1 G A 9: 108,082,828 R328H probably damaging Het
Nav3 C A 10: 109,853,477 S313I probably benign Het
Nmt2 T G 2: 3,284,315 S7A probably benign Het
Nsmce1 T C 7: 125,469,082 S197G probably benign Het
Ociad2 A G 5: 73,335,875 V4A probably benign Het
Olfr680-ps1 G T 7: 105,092,798 T7K probably benign Het
Osmr T C 15: 6,821,088 D679G possibly damaging Het
Pappa T A 4: 65,189,450 F699L probably benign Het
Parp8 T A 13: 117,025,266 M40L probably benign Het
Pcyox1 A T 6: 86,394,537 N122K possibly damaging Het
Pkd1l1 T C 11: 8,890,737 S1224G Het
Pkd1l3 T A 8: 109,636,340 S1088T probably damaging Het
Prrt1 T C 17: 34,631,077 V155A probably benign Het
Rbm6 A C 9: 107,853,211 D79E probably damaging Het
Sec31b A T 19: 44,518,936 S819T probably benign Het
Slc22a27 A T 19: 7,926,547 I75N probably damaging Het
Slc25a54 G A 3: 109,098,589 G138R probably damaging Het
Slc6a12 T C 6: 121,365,319 S612P probably benign Het
Slc7a2 A T 8: 40,915,013 I605F probably benign Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Strbp A T 2: 37,624,502 H308Q probably benign Het
Stxbp4 G A 11: 90,607,009 Q155* probably null Het
Sybu A T 15: 44,677,714 N317K possibly damaging Het
Taok1 G A 11: 77,571,633 S210F probably damaging Het
Tapbp A G 17: 33,920,048 D72G possibly damaging Het
Thbd G T 2: 148,406,541 T469K probably benign Het
Tia1 T C 6: 86,427,688 Y302H possibly damaging Het
Tlr4 T C 4: 66,840,283 F438L probably benign Het
Tmem235 C T 11: 117,860,897 S49L probably damaging Het
Trip4 A G 9: 65,885,221 probably benign Het
Trrap C A 5: 144,803,178 L1137I possibly damaging Het
Vmo1 T C 11: 70,513,848 E109G probably benign Het
Wdfy4 T C 14: 33,151,578 Y258C Het
Wdr91 T G 6: 34,908,263 N121T possibly damaging Het
Zfp39 T C 11: 58,890,559 H459R probably damaging Het
Zfp936 T A 7: 43,190,291 I394K possibly damaging Het
Zpr1 G A 9: 46,281,059 D423N probably damaging Het
Other mutations in Dmtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Dmtn APN 14 70604819 missense probably damaging 1.00
IGL02836:Dmtn APN 14 70616078 missense probably damaging 1.00
R1248:Dmtn UTSW 14 70612658 splice site probably benign
R2428:Dmtn UTSW 14 70613403 missense probably damaging 1.00
R3438:Dmtn UTSW 14 70612716 missense probably damaging 0.98
R4851:Dmtn UTSW 14 70604814 missense probably damaging 1.00
R4917:Dmtn UTSW 14 70605719 missense probably damaging 0.98
R4924:Dmtn UTSW 14 70617959 missense probably benign 0.25
R5633:Dmtn UTSW 14 70604979 missense probably benign 0.18
R6170:Dmtn UTSW 14 70617355 missense probably damaging 1.00
R6214:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6215:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6639:Dmtn UTSW 14 70617430 missense probably damaging 1.00
R6860:Dmtn UTSW 14 70614882 missense possibly damaging 0.94
R7242:Dmtn UTSW 14 70618020 missense probably damaging 1.00
R7380:Dmtn UTSW 14 70617328 missense probably damaging 0.99
R7572:Dmtn UTSW 14 70605337 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAACAGTGCTCACTCCTGC -3'
(R):5'- CTAGTTGCAGAGAGCCTCAGAG -3'

Sequencing Primer
(F):5'- AGTGCTCACTCCTGCGCATAG -3'
(R):5'- TTCAAGGCCAGATGCAGC -3'
Posted On2019-05-15