Incidental Mutation 'R7139:Tapbp'
ID553309
Institutional Source Beutler Lab
Gene Symbol Tapbp
Ensembl Gene ENSMUSG00000024308
Gene NameTAP binding protein
SynonymsTPN, tapasin, D17Wsu91e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7139 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33915899-33929288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33920048 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 72 (D72G)
Ref Sequence ENSEMBL: ENSMUSP00000025161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025161
AA Change: D72G

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308
AA Change: D72G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079421
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170075
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172619
AA Change: D63G

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308
AA Change: D63G

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174146
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174541
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced and thermolabile MHC class I surface expression due to impaired peptide loading with stabilizing peptides, impaired T cell selection, altered NK repertoire, lower CD8+ T cell numbers, and impaired responses to select class I-restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,941,838 R272G possibly damaging Het
4930512M02Rik T A 11: 11,590,078 N179Y unknown Het
4930562C15Rik A T 16: 4,850,184 M480L probably benign Het
Abcd4 A G 12: 84,606,298 C377R probably benign Het
Adam23 C A 1: 63,545,577 D381E probably damaging Het
Angpt1 T A 15: 42,676,351 Q37H probably damaging Het
Apeh A T 9: 108,092,146 F260I probably damaging Het
Cadps2 T C 6: 23,410,889 Y681C probably damaging Het
Ccdc162 T C 10: 41,666,721 M386V possibly damaging Het
Celsr2 T C 3: 108,415,359 S46G unknown Het
Cfc1 T C 1: 34,536,479 L78P probably benign Het
Chd7 T C 4: 8,865,865 V2724A probably benign Het
Clca3a1 A T 3: 144,755,302 V196E possibly damaging Het
Cma1 T C 14: 55,943,816 H44R probably damaging Het
Cnot2 T C 10: 116,495,019 N394S probably benign Het
Cstf3 A T 2: 104,653,064 I372F possibly damaging Het
Cyb5rl A C 4: 107,071,011 I115L probably benign Het
D5Ertd579e A G 5: 36,613,976 L1025P probably damaging Het
Dmtn T C 14: 70,617,427 N36S probably benign Het
Dnah6 A G 6: 73,135,680 V1647A probably damaging Het
Dock6 T C 9: 21,801,276 Y2063C probably damaging Het
Dst T A 1: 34,299,807 D5149E probably damaging Het
Fancl A G 11: 26,403,358 M85V probably benign Het
Fgd2 T A 17: 29,373,255 F387Y probably damaging Het
Fshr A T 17: 88,986,161 I363N possibly damaging Het
Glce G T 9: 62,070,434 S56* probably null Het
Gm26727 A T 2: 67,433,037 S49T unknown Het
Gm36210 T A 7: 4,899,278 D131V probably damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2afy2 T A 10: 61,757,895 M1L unknown Het
H2-Eb2 C T 17: 34,334,421 R194W probably benign Het
Hivep1 A T 13: 42,159,954 E1890V probably benign Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Ighv2-5 T A 12: 113,685,599 Y78F probably benign Het
Il9 C T 13: 56,480,613 V88I probably benign Het
Kidins220 A G 12: 24,994,821 T163A probably damaging Het
Lama4 G T 10: 39,075,495 D1079Y probably damaging Het
Lman1l A T 9: 57,615,596 H160Q probably benign Het
Lrrc34 T C 3: 30,624,887 I354V probably benign Het
Mpeg1 A T 19: 12,461,714 T179S probably benign Het
Mrgpra2a A T 7: 47,426,589 L307H probably damaging Het
Mst1 G A 9: 108,082,828 R328H probably damaging Het
Nav3 C A 10: 109,853,477 S313I probably benign Het
Nmt2 T G 2: 3,284,315 S7A probably benign Het
Nsmce1 T C 7: 125,469,082 S197G probably benign Het
Ociad2 A G 5: 73,335,875 V4A probably benign Het
Olfr680-ps1 G T 7: 105,092,798 T7K probably benign Het
Osmr T C 15: 6,821,088 D679G possibly damaging Het
Pappa T A 4: 65,189,450 F699L probably benign Het
Parp8 T A 13: 117,025,266 M40L probably benign Het
Pcyox1 A T 6: 86,394,537 N122K possibly damaging Het
Pkd1l1 T C 11: 8,890,737 S1224G Het
Pkd1l3 T A 8: 109,636,340 S1088T probably damaging Het
Prrt1 T C 17: 34,631,077 V155A probably benign Het
Rbm6 A C 9: 107,853,211 D79E probably damaging Het
Sec31b A T 19: 44,518,936 S819T probably benign Het
Slc22a27 A T 19: 7,926,547 I75N probably damaging Het
Slc25a54 G A 3: 109,098,589 G138R probably damaging Het
Slc6a12 T C 6: 121,365,319 S612P probably benign Het
Slc7a2 A T 8: 40,915,013 I605F probably benign Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Strbp A T 2: 37,624,502 H308Q probably benign Het
Stxbp4 G A 11: 90,607,009 Q155* probably null Het
Sybu A T 15: 44,677,714 N317K possibly damaging Het
Taok1 G A 11: 77,571,633 S210F probably damaging Het
Thbd G T 2: 148,406,541 T469K probably benign Het
Tia1 T C 6: 86,427,688 Y302H possibly damaging Het
Tlr4 T C 4: 66,840,283 F438L probably benign Het
Tmem235 C T 11: 117,860,897 S49L probably damaging Het
Trip4 A G 9: 65,885,221 probably benign Het
Trrap C A 5: 144,803,178 L1137I possibly damaging Het
Vmo1 T C 11: 70,513,848 E109G probably benign Het
Wdfy4 T C 14: 33,151,578 Y258C Het
Wdr91 T G 6: 34,908,263 N121T possibly damaging Het
Zfp39 T C 11: 58,890,559 H459R probably damaging Het
Zfp936 T A 7: 43,190,291 I394K possibly damaging Het
Zpr1 G A 9: 46,281,059 D423N probably damaging Het
Other mutations in Tapbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tapbp APN 17 33919892 missense probably benign
IGL00229:Tapbp APN 17 33925704 missense probably damaging 1.00
R0002:Tapbp UTSW 17 33925632 missense probably damaging 0.98
R0416:Tapbp UTSW 17 33925418 missense probably damaging 0.99
R0800:Tapbp UTSW 17 33926253 missense probably benign 0.39
R0839:Tapbp UTSW 17 33925743 missense probably benign 0.00
R1584:Tapbp UTSW 17 33919940 unclassified probably null
R1617:Tapbp UTSW 17 33920431 missense probably benign 0.06
R2214:Tapbp UTSW 17 33920326 missense possibly damaging 0.90
R3941:Tapbp UTSW 17 33920483 missense possibly damaging 0.91
R4570:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4571:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4935:Tapbp UTSW 17 33925622 missense probably benign 0.02
R6195:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6233:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6468:Tapbp UTSW 17 33926098 missense probably damaging 1.00
R6736:Tapbp UTSW 17 33919957 missense possibly damaging 0.85
R7146:Tapbp UTSW 17 33925487 missense possibly damaging 0.93
R7233:Tapbp UTSW 17 33919969 missense probably damaging 0.99
R7448:Tapbp UTSW 17 33920417 missense possibly damaging 0.70
R7630:Tapbp UTSW 17 33920344 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTTTAGGAATAGACACACTGGG -3'
(R):5'- TAGCCCGGACTGGAAATGTG -3'

Sequencing Primer
(F):5'- GACATCCTATGGCCCTCTGG -3'
(R):5'- TGTGCTGACTACACACAGG -3'
Posted On2019-05-15