Incidental Mutation 'R7141:Kcp'
ID553333
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Namekielin/chordin-like protein
SynonymsCrim2, KCP, LOC333088
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29473162-29507952 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 29487512 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1106 (Y1106*)
Ref Sequence ENSEMBL: ENSMUSP00000099135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]
Predicted Effect probably null
Transcript: ENSMUST00000078112
AA Change: Y1106*
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: Y1106*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091391
AA Change: Y1105*
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: Y1105*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101614
AA Change: Y1106*
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: Y1106*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159479
SMART Domains Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 1 51 4.56e-1 SMART
VWC 54 110 1.98e-8 SMART
VWC 113 169 1.35e-1 SMART
VWC 172 228 5.77e-10 SMART
VWC 231 286 1.21e-3 SMART
VWC 289 353 6.53e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161276
Meta Mutation Damage Score 0.9580 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29482657 missense probably benign
IGL01344:Kcp APN 6 29498951 splice site probably null
IGL01404:Kcp APN 6 29496639 missense probably damaging 0.99
IGL01735:Kcp APN 6 29498879 missense probably damaging 1.00
IGL01776:Kcp APN 6 29497908 missense probably damaging 1.00
IGL02092:Kcp APN 6 29489032 critical splice donor site probably null
IGL02252:Kcp APN 6 29504549 missense probably damaging 1.00
IGL02690:Kcp APN 6 29484999 unclassified probably benign
IGL02817:Kcp APN 6 29496969 missense probably damaging 0.97
IGL03074:Kcp APN 6 29496631 missense probably damaging 1.00
P0045:Kcp UTSW 6 29498348 missense probably damaging 1.00
R0219:Kcp UTSW 6 29495785 missense probably damaging 1.00
R0355:Kcp UTSW 6 29496927 missense possibly damaging 0.89
R0738:Kcp UTSW 6 29490439 missense probably benign 0.24
R1111:Kcp UTSW 6 29485423 missense probably benign
R1304:Kcp UTSW 6 29501292 unclassified probably benign
R1663:Kcp UTSW 6 29498965 missense possibly damaging 0.68
R1808:Kcp UTSW 6 29505655 missense probably benign 0.05
R1907:Kcp UTSW 6 29497835 unclassified probably benign
R2030:Kcp UTSW 6 29489072 missense probably damaging 1.00
R2099:Kcp UTSW 6 29496165 nonsense probably null
R3411:Kcp UTSW 6 29482846 missense possibly damaging 0.68
R3982:Kcp UTSW 6 29484637 missense probably damaging 1.00
R3983:Kcp UTSW 6 29484637 missense probably damaging 1.00
R4223:Kcp UTSW 6 29482258 missense possibly damaging 0.55
R4377:Kcp UTSW 6 29493203 missense probably damaging 1.00
R4570:Kcp UTSW 6 29491848 nonsense probably null
R4624:Kcp UTSW 6 29482814 missense possibly damaging 0.94
R4694:Kcp UTSW 6 29493197 missense probably benign 0.29
R4750:Kcp UTSW 6 29484626 missense probably benign 0.03
R4968:Kcp UTSW 6 29497629 nonsense probably null
R5053:Kcp UTSW 6 29496958 missense probably benign 0.01
R5067:Kcp UTSW 6 29492108 missense probably benign 0.06
R5253:Kcp UTSW 6 29498520 unclassified probably benign
R5418:Kcp UTSW 6 29504284 nonsense probably null
R6020:Kcp UTSW 6 29502864 missense probably benign 0.03
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6088:Kcp UTSW 6 29502632 missense probably benign
R6178:Kcp UTSW 6 29482888 missense possibly damaging 0.68
R6285:Kcp UTSW 6 29502365 missense probably benign 0.21
R6310:Kcp UTSW 6 29493258 missense probably damaging 0.98
R6369:Kcp UTSW 6 29484694 missense probably damaging 1.00
R6860:Kcp UTSW 6 29505720 missense probably benign 0.19
R6949:Kcp UTSW 6 29484612 splice site probably null
R6962:Kcp UTSW 6 29482840 missense probably benign 0.08
R7006:Kcp UTSW 6 29499170 missense probably damaging 1.00
R7138:Kcp UTSW 6 29491862 nonsense probably null
R7153:Kcp UTSW 6 29499015 missense probably damaging 1.00
R7162:Kcp UTSW 6 29497200 intron probably null
R7334:Kcp UTSW 6 29485512 missense probably damaging 1.00
R7565:Kcp UTSW 6 29499187 missense probably damaging 1.00
R7671:Kcp UTSW 6 29496517 missense probably benign 0.02
R7766:Kcp UTSW 6 29496847 missense probably damaging 0.98
R7781:Kcp UTSW 6 29497765 missense probably damaging 1.00
Z1176:Kcp UTSW 6 29485012 missense probably benign 0.23
Z1177:Kcp UTSW 6 29485525 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AAACAGCAGATCTTGTGGGG -3'
(R):5'- AGCCAAGTTCTCCCAAGAGG -3'

Sequencing Primer
(F):5'- CAGCAGATCTTGTGGGGTTGTG -3'
(R):5'- CTGAGTAACTGCACAGAG -3'
Posted On2019-05-15