Incidental Mutation 'R7141:Casp2'
ID553334
Institutional Source Beutler Lab
Gene Symbol Casp2
Ensembl Gene ENSMUSG00000029863
Gene Namecaspase 2
SynonymsNedd2, Caspase-2, Ich-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42264985-42282508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42280395 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 426 (F426S)
Ref Sequence ENSEMBL: ENSMUSP00000031895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031895] [ENSMUST00000156829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031895
AA Change: F426S

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031895
Gene: ENSMUSG00000029863
AA Change: F426S

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 447 3.27e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156829
SMART Domains Protein: ENSMUSP00000121184
Gene: ENSMUSG00000029863

DomainStartEndE-ValueType
CARD 32 120 2.27e-32 SMART
CASc 191 341 8.07e-38 SMART
Meta Mutation Damage Score 0.0957 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes the evolutionarily ancient and most conserved member of the cysteine proteases that plays important role in stress-induced apoptosis, DNA repair and tumor suppression. Mice lacking the encoded protein develop normally but display cell type-specific apoptotic defects. Germ cells and oocytes from such mice were found to be resistant to cell death after treatment with chemotherapeutic drugs. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal apoptosis. Apoptosis is reduced in the female germline, but is increased in sympathetic neurons during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Casp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Casp2 APN 6 42269285 nonsense probably null
IGL02094:Casp2 APN 6 42280359 missense probably damaging 1.00
IGL02371:Casp2 APN 6 42267968 missense probably benign 0.00
IGL02414:Casp2 APN 6 42280446 missense probably damaging 1.00
IGL03298:Casp2 APN 6 42268990 splice site probably benign
R1240:Casp2 UTSW 6 42268945 missense probably damaging 1.00
R1424:Casp2 UTSW 6 42276791 splice site probably benign
R1672:Casp2 UTSW 6 42268908 missense probably damaging 1.00
R4110:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R4113:Casp2 UTSW 6 42267894 missense probably damaging 1.00
R5062:Casp2 UTSW 6 42269272 splice site probably benign
R5469:Casp2 UTSW 6 42269334 missense probably benign 0.00
R5835:Casp2 UTSW 6 42267586 missense possibly damaging 0.84
R5877:Casp2 UTSW 6 42276637 intron probably benign
R6103:Casp2 UTSW 6 42279880 missense probably damaging 0.99
R6667:Casp2 UTSW 6 42279836 missense probably damaging 1.00
R6702:Casp2 UTSW 6 42268051 missense probably benign
R6754:Casp2 UTSW 6 42269330 missense probably damaging 1.00
R7255:Casp2 UTSW 6 42268907 missense probably damaging 1.00
R7611:Casp2 UTSW 6 42274038 missense possibly damaging 0.95
X0065:Casp2 UTSW 6 42280143 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTAAGTCCGTTCCAGCTG -3'
(R):5'- CTGGGAGAATCTCATATCCCTGAG -3'

Sequencing Primer
(F):5'- GTTCCAGCTGCCTCCACAAG -3'
(R):5'- GAGGGTAGACAGAACAAAAACCATTC -3'
Posted On2019-05-15