Incidental Mutation 'R7141:Nr1h4'
ID553349
Institutional Source Beutler Lab
Gene Symbol Nr1h4
Ensembl Gene ENSMUSG00000047638
Gene Namenuclear receptor subfamily 1, group H, member 4
SynonymsRxrip14, FXR, HRR1, Fxr, RIP14
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location89454234-89533585 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 89498229 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 100 (R100*)
Ref Sequence ENSEMBL: ENSMUSP00000100933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058126] [ENSMUST00000105296] [ENSMUST00000105297]
Predicted Effect probably null
Transcript: ENSMUST00000058126
AA Change: R100*
SMART Domains Protein: ENSMUSP00000053092
Gene: ENSMUSG00000047638
AA Change: R100*

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 235 285 4e-19 BLAST
HOLI 301 456 9.43e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105296
AA Change: R100*
SMART Domains Protein: ENSMUSP00000100933
Gene: ENSMUSG00000047638
AA Change: R100*

DomainStartEndE-ValueType
ZnF_C4 135 206 1.93e-37 SMART
Blast:HOLI 239 289 4e-19 BLAST
HOLI 305 460 9.43e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105297
AA Change: R86*
SMART Domains Protein: ENSMUSP00000100934
Gene: ENSMUSG00000047638
AA Change: R86*

DomainStartEndE-ValueType
ZnF_C4 121 192 1.93e-37 SMART
Blast:HOLI 225 275 3e-19 BLAST
HOLI 291 446 9.43e-32 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ligand-activated transcription factor that shares structural features in common with nuclear hormone receptor family members. This protein functions as a receptor for bile acids, and when bound to bile acids, binds to DNA and regulates the expression of genes involved in bile acid synthesis and transport. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit increased bile salts and abnormal liver morphology and physiology. Mice homozygous for one knock-out allele also exhibit abnormal lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Nr1h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Nr1h4 APN 10 89478807 missense probably benign 0.42
IGL02628:Nr1h4 APN 10 89473839 missense probably damaging 1.00
Aeronaut UTSW 10 89498229 nonsense probably null
I1329:Nr1h4 UTSW 10 89483362 splice site probably benign
IGL02837:Nr1h4 UTSW 10 89516480 missense probably benign 0.00
R0590:Nr1h4 UTSW 10 89456567 missense probably damaging 0.99
R0645:Nr1h4 UTSW 10 89506528 missense probably benign 0.08
R1887:Nr1h4 UTSW 10 89454867 missense possibly damaging 0.64
R1905:Nr1h4 UTSW 10 89480559 missense possibly damaging 0.85
R2471:Nr1h4 UTSW 10 89473894 missense probably damaging 1.00
R2921:Nr1h4 UTSW 10 89498361 missense probably damaging 1.00
R3177:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R3277:Nr1h4 UTSW 10 89478788 missense possibly damaging 0.89
R4656:Nr1h4 UTSW 10 89498253 missense probably benign 0.00
R4676:Nr1h4 UTSW 10 89473874 missense probably damaging 1.00
R4901:Nr1h4 UTSW 10 89478797 missense possibly damaging 0.68
R4993:Nr1h4 UTSW 10 89498180 missense probably benign 0.01
R5117:Nr1h4 UTSW 10 89478422 missense probably damaging 1.00
R5131:Nr1h4 UTSW 10 89483455 missense probably damaging 0.99
R5176:Nr1h4 UTSW 10 89498255 missense probably benign 0.02
R5241:Nr1h4 UTSW 10 89483489 missense probably damaging 1.00
R5580:Nr1h4 UTSW 10 89516440 missense probably benign 0.16
R6114:Nr1h4 UTSW 10 89478816 missense possibly damaging 0.61
R6814:Nr1h4 UTSW 10 89454745 missense probably damaging 0.98
R6888:Nr1h4 UTSW 10 89456542 missense probably damaging 1.00
R6990:Nr1h4 UTSW 10 89454930 missense probably benign 0.18
R7427:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7428:Nr1h4 UTSW 10 89498405 missense probably benign 0.00
R7560:Nr1h4 UTSW 10 89498261 missense probably benign
R7986:Nr1h4 UTSW 10 89454772 missense possibly damaging 0.46
R8881:Nr1h4 UTSW 10 89483489 missense probably damaging 1.00
X0023:Nr1h4 UTSW 10 89454844 missense possibly damaging 0.45
Z1176:Nr1h4 UTSW 10 89498350 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGCAGCCACCTCAGTATAATTG -3'
(R):5'- ATGCTAACAGAACACGCGGC -3'

Sequencing Primer
(F):5'- GAAAGCTCTCACCTTTGCAG -3'
(R):5'- AGCCACAGATTTCCTCCT -3'
Posted On2019-05-15