Incidental Mutation 'R0600:Apob'
ID55335
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 038789-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R0600 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8006440 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 1608 (H1608N)
Ref Sequence ENSEMBL: ENSMUSP00000035761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811]
Predicted Effect probably damaging
Transcript: ENSMUST00000037520
AA Change: H1608N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: H1608N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037811
AA Change: H1641N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: H1641N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Meta Mutation Damage Score 0.2825 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,357,660 S150P probably damaging Het
4932431P20Rik T A 7: 29,533,265 noncoding transcript Het
5530400C23Rik T G 6: 133,293,211 probably benign Het
Ahctf1 A C 1: 179,763,468 probably null Het
Ang5 T C 14: 43,962,749 V90A probably benign Het
Ano9 C T 7: 141,104,710 G442R probably damaging Het
Apaf1 G A 10: 91,060,052 T386I probably damaging Het
Arhgap12 C A 18: 6,064,433 probably benign Het
Asxl1 T A 2: 153,399,904 D791E probably benign Het
Avl9 T C 6: 56,736,906 V383A probably benign Het
Btbd1 A C 7: 81,816,006 D197E probably damaging Het
C87499 A T 4: 88,629,299 I45K probably damaging Het
Camta2 T C 11: 70,673,959 I938V possibly damaging Het
Cdca7 C A 2: 72,483,467 A200D possibly damaging Het
Cep104 A T 4: 154,006,792 Y923F possibly damaging Het
Cep135 G C 5: 76,621,305 V601L probably benign Het
Ces2b G A 8: 104,835,910 G291S probably benign Het
Col6a6 C T 9: 105,761,440 G1400D probably damaging Het
Cyth2 T C 7: 45,813,117 E1G probably damaging Het
Dand5 A T 8: 84,816,292 L185Q probably damaging Het
Dck T C 5: 88,781,221 V253A probably benign Het
Ddx20 A G 3: 105,679,080 S650P probably damaging Het
Dicer1 G A 12: 104,706,864 P799S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eya2 G A 2: 165,769,237 C477Y probably damaging Het
Fam208b A T 13: 3,576,054 F1299I probably benign Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Galntl6 T C 8: 57,837,183 probably null Het
Gda A T 19: 21,434,303 F44I possibly damaging Het
Gli2 G A 1: 118,840,389 R703C probably damaging Het
Gm14085 A T 2: 122,514,398 I162F probably damaging Het
Golgb1 T A 16: 36,916,271 L1960Q probably damaging Het
Gramd1b T C 9: 40,308,355 D341G probably damaging Het
Grid2 G T 6: 63,503,435 A78S probably benign Het
Hao2 A T 3: 98,883,560 probably benign Het
Hook3 A G 8: 26,118,986 V10A probably benign Het
Kif20a A G 18: 34,629,209 E425G probably damaging Het
Lrp1 T C 10: 127,567,383 D2107G probably benign Het
Lrriq3 T C 3: 155,187,736 I358T possibly damaging Het
Mad2l2 A G 4: 148,140,924 D17G possibly damaging Het
Mastl G T 2: 23,133,346 T455K probably benign Het
Mkln1 G T 6: 31,432,927 probably benign Het
Mmp1b A T 9: 7,387,947 Y16N possibly damaging Het
Mmp24 C T 2: 155,792,597 A79V probably benign Het
Mrps35 T A 6: 147,070,734 C292S possibly damaging Het
Myom1 T C 17: 71,120,648 F1435L possibly damaging Het
Nars2 C T 7: 97,039,923 H351Y probably damaging Het
Nat2 A T 8: 67,501,267 I10F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm5 A T 7: 104,153,869 Y462* probably null Het
Olfr1228 C A 2: 89,249,398 E87* probably null Het
Olfr1339 C T 4: 118,734,789 H87Y probably damaging Het
Olfr1508 T C 14: 52,463,509 I167V probably benign Het
Olfr322 C A 11: 58,666,160 F200L probably damaging Het
Olfr340 C A 2: 36,452,648 A21E probably benign Het
Olfr44 A T 9: 39,484,988 F85L probably benign Het
Olfr495 T A 7: 108,395,231 I37N probably damaging Het
Olfr855 T C 9: 19,585,304 S256P possibly damaging Het
Olfr926 T A 9: 38,877,815 I213N probably damaging Het
Otog A T 7: 46,251,395 probably benign Het
Pdcd2l A T 7: 34,192,807 D212E possibly damaging Het
Pex5 T C 6: 124,404,637 N213S probably benign Het
Pkn3 C T 2: 30,081,134 P238S probably benign Het
Prl2b1 A T 13: 27,390,740 probably null Het
Ptprb A T 10: 116,368,807 I1849L possibly damaging Het
Rasal3 G T 17: 32,393,526 S787Y probably damaging Het
Scn2a T A 2: 65,701,833 D596E possibly damaging Het
Sdhd A T 9: 50,603,764 V9D possibly damaging Het
Serinc5 T C 13: 92,708,057 S436P probably damaging Het
Slc27a1 C T 8: 71,584,164 P348L probably damaging Het
Smg1 G A 7: 118,160,383 probably benign Het
Sorl1 A T 9: 42,043,900 probably benign Het
Sprtn T A 8: 124,900,218 H112Q probably damaging Het
Tet2 A G 3: 133,467,602 M1633T probably benign Het
Tet2 T A 3: 133,467,725 D1592V probably benign Het
Tmem68 A T 4: 3,569,667 C8S probably damaging Het
Tnrc6a T A 7: 123,171,816 I943N probably benign Het
Trib2 A T 12: 15,794,068 V191D probably damaging Het
Tsc22d4 T C 5: 137,762,655 S113P probably damaging Het
Ttc21b T C 2: 66,239,570 R250G probably damaging Het
Ubr2 T C 17: 46,967,248 Y721C probably damaging Het
Ubtfl1 A T 9: 18,409,364 I63F probably damaging Het
Ush1c G A 7: 46,224,908 P171S probably benign Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vangl1 A G 3: 102,166,937 Y285H probably damaging Het
Virma A G 4: 11,498,769 D70G probably damaging Het
Vmn2r102 T C 17: 19,678,015 F431L probably benign Het
Wdr17 A G 8: 54,661,495 I662T probably damaging Het
Wisp2 G A 2: 163,825,313 C78Y probably damaging Het
Zfp160 G A 17: 21,027,006 R606H probably benign Het
Zfp369 C T 13: 65,296,434 R464C probably damaging Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
Aesthete UTSW 12 8010080 nonsense probably null
Essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 splice site probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
R7474:Apob UTSW 12 8009185 missense probably benign 0.29
R7484:Apob UTSW 12 8006884 nonsense probably null
R7538:Apob UTSW 12 8002219 missense probably damaging 0.98
R7636:Apob UTSW 12 8009516 missense possibly damaging 0.86
R7646:Apob UTSW 12 8009189 missense probably damaging 0.99
R7787:Apob UTSW 12 7990780 missense probably damaging 0.97
R7793:Apob UTSW 12 8008124 missense probably damaging 0.99
R7836:Apob UTSW 12 8001885 missense possibly damaging 0.72
R7895:Apob UTSW 12 8011933 missense probably benign 0.00
R8005:Apob UTSW 12 8009744 missense probably benign 0.01
R8013:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8014:Apob UTSW 12 8010798 missense possibly damaging 0.94
R8111:Apob UTSW 12 8008801 missense probably benign 0.16
R8117:Apob UTSW 12 8006435 missense probably damaging 0.99
R8226:Apob UTSW 12 8009056 missense probably benign 0.00
R8244:Apob UTSW 12 8010548 missense probably damaging 0.96
R8280:Apob UTSW 12 8010851 missense possibly damaging 0.46
R8310:Apob UTSW 12 8009033 missense probably benign 0.00
R8327:Apob UTSW 12 8001015 missense possibly damaging 0.72
R8329:Apob UTSW 12 8011135 missense probably damaging 0.98
R8331:Apob UTSW 12 8001882 missense probably benign 0.28
R8351:Apob UTSW 12 8006356 missense probably benign 0.29
R8412:Apob UTSW 12 8008069 missense probably benign 0.33
R8425:Apob UTSW 12 7988842 missense possibly damaging 0.70
R8481:Apob UTSW 12 7994807 splice site probably null
R8493:Apob UTSW 12 8009009 missense possibly damaging 0.87
R8529:Apob UTSW 12 8007353 missense probably damaging 1.00
R8554:Apob UTSW 12 7987830 missense probably damaging 0.98
R8692:Apob UTSW 12 8008270 missense probably damaging 0.98
R8695:Apob UTSW 12 8007830 missense probably damaging 1.00
R8977:Apob UTSW 12 8015990 missense probably damaging 0.99
R9020:Apob UTSW 12 8013999 missense probably damaging 1.00
R9037:Apob UTSW 12 8016501 missense probably benign 0.15
R9053:Apob UTSW 12 8008954 missense possibly damaging 0.72
R9062:Apob UTSW 12 8008046 missense possibly damaging 0.91
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Z1176:Apob UTSW 12 7998011 missense probably damaging 1.00
Z1176:Apob UTSW 12 8004978 missense probably benign 0.00
Z1177:Apob UTSW 12 7988765 missense probably benign 0.43
Z1177:Apob UTSW 12 8015249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAACAAGCTGGATGTGACCTTCTC -3'
(R):5'- ATCATGGCCTGGTAAATGCTCCCC -3'

Sequencing Primer
(F):5'- GATGTGACCTTCTCTACGCAAAG -3'
(R):5'- TGGTAAATGCTCCCCAGTGAC -3'
Posted On2013-07-11