Mutagenetix > Incidental Mutation

Incidental Mutation 'R0600:Apob'

55335

Institutional Source

Beutler Lab

Gene Symbol

Apob

Ensembl Gene

ENSMUSG00000020609

Gene Name

apolipoprotein B

Synonyms

apob-100, apob-48

MMRRC Submission

038789-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.866) question?

Stock #

R0600 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7977648-8016835 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 8006440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 1608 (H1608N)

Ref Sequence

ENSEMBL: ENSMUSP00000035761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000037520
AA Change: H1608N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: H1608N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	33	585	6.03e-94	SMART
DUF1943	619	932	7.88e-97	SMART
Pfam:DUF1081	945	1059	9.4e-32	PFAM
low complexity region	1100	1109	N/A	INTRINSIC
Blast:LPD_N	1249	1311	9e-22	BLAST
low complexity region	1632	1644	N/A	INTRINSIC
internal_repeat_1	1882	2038	6.61e-9	PROSPERO
SCOP:d1gw5a_	2105	2577	9e-5	SMART
internal_repeat_1	2973	3150	6.61e-9	PROSPERO
low complexity region	3561	3580	N/A	INTRINSIC
low complexity region	3928	3936	N/A	INTRINSIC
Pfam:ApoB100_C	4401	4456	5.6e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037811
AA Change: H1641N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: H1641N

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	46	598	6.03e-94	SMART
DUF1943	632	945	7.88e-97	SMART
Pfam:DUF1081	960	1070	6.3e-39	PFAM
low complexity region	1113	1122	N/A	INTRINSIC
Blast:LPD_N	1282	1344	1e-21	BLAST
low complexity region	1665	1677	N/A	INTRINSIC
internal_repeat_1	1915	2071	6.6e-9	PROSPERO
SCOP:d1gw5a_	2138	2610	9e-5	SMART
internal_repeat_1	3006	3183	6.6e-9	PROSPERO
low complexity region	3594	3613	N/A	INTRINSIC
low complexity region	3961	3969	N/A	INTRINSIC
Pfam:ApoB100_C	4434	4490	1.6e-32	PFAM

Meta Mutation Damage Score

0.2825

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.5%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,357,660	S150P	probably damaging	Het
4932431P20Rik	T	A	7: 29,533,265		noncoding transcript	Het
5530400C23Rik	T	G	6: 133,293,211		probably benign	Het
Ahctf1	A	C	1: 179,763,468		probably null	Het
Ang5	T	C	14: 43,962,749	V90A	probably benign	Het
Ano9	C	T	7: 141,104,710	G442R	probably damaging	Het
Apaf1	G	A	10: 91,060,052	T386I	probably damaging	Het
Arhgap12	C	A	18: 6,064,433		probably benign	Het
Asxl1	T	A	2: 153,399,904	D791E	probably benign	Het
Avl9	T	C	6: 56,736,906	V383A	probably benign	Het
Btbd1	A	C	7: 81,816,006	D197E	probably damaging	Het
C87499	A	T	4: 88,629,299	I45K	probably damaging	Het
Camta2	T	C	11: 70,673,959	I938V	possibly damaging	Het
Cdca7	C	A	2: 72,483,467	A200D	possibly damaging	Het
Cep104	A	T	4: 154,006,792	Y923F	possibly damaging	Het
Cep135	G	C	5: 76,621,305	V601L	probably benign	Het
Ces2b	G	A	8: 104,835,910	G291S	probably benign	Het
Col6a6	C	T	9: 105,761,440	G1400D	probably damaging	Het
Cyth2	T	C	7: 45,813,117	E1G	probably damaging	Het
Dand5	A	T	8: 84,816,292	L185Q	probably damaging	Het
Dck	T	C	5: 88,781,221	V253A	probably benign	Het
Ddx20	A	G	3: 105,679,080	S650P	probably damaging	Het
Dicer1	G	A	12: 104,706,864	P799S	probably damaging	Het
Dst	C	T	1: 34,189,119	P1606L	probably damaging	Het
Eya2	G	A	2: 165,769,237	C477Y	probably damaging	Het
Fam208b	A	T	13: 3,576,054	F1299I	probably benign	Het
Fip1l1	T	A	5: 74,595,842	N498K	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Galntl6	T	C	8: 57,837,183		probably null	Het
Gda	A	T	19: 21,434,303	F44I	possibly damaging	Het
Gli2	G	A	1: 118,840,389	R703C	probably damaging	Het
Gm14085	A	T	2: 122,514,398	I162F	probably damaging	Het
Golgb1	T	A	16: 36,916,271	L1960Q	probably damaging	Het
Gramd1b	T	C	9: 40,308,355	D341G	probably damaging	Het
Grid2	G	T	6: 63,503,435	A78S	probably benign	Het
Hao2	A	T	3: 98,883,560		probably benign	Het
Hook3	A	G	8: 26,118,986	V10A	probably benign	Het
Kif20a	A	G	18: 34,629,209	E425G	probably damaging	Het
Lrp1	T	C	10: 127,567,383	D2107G	probably benign	Het
Lrriq3	T	C	3: 155,187,736	I358T	possibly damaging	Het
Mad2l2	A	G	4: 148,140,924	D17G	possibly damaging	Het
Mastl	G	T	2: 23,133,346	T455K	probably benign	Het
Mkln1	G	T	6: 31,432,927		probably benign	Het
Mmp1b	A	T	9: 7,387,947	Y16N	possibly damaging	Het
Mmp24	C	T	2: 155,792,597	A79V	probably benign	Het
Mrps35	T	A	6: 147,070,734	C292S	possibly damaging	Het
Myom1	T	C	17: 71,120,648	F1435L	possibly damaging	Het
Nars2	C	T	7: 97,039,923	H351Y	probably damaging	Het
Nat2	A	T	8: 67,501,267	I10F	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Olfm5	A	T	7: 104,153,869	Y462*	probably null	Het
Olfr1228	C	A	2: 89,249,398	E87*	probably null	Het
Olfr1339	C	T	4: 118,734,789	H87Y	probably damaging	Het
Olfr1508	T	C	14: 52,463,509	I167V	probably benign	Het
Olfr322	C	A	11: 58,666,160	F200L	probably damaging	Het
Olfr340	C	A	2: 36,452,648	A21E	probably benign	Het
Olfr44	A	T	9: 39,484,988	F85L	probably benign	Het
Olfr495	T	A	7: 108,395,231	I37N	probably damaging	Het
Olfr855	T	C	9: 19,585,304	S256P	possibly damaging	Het
Olfr926	T	A	9: 38,877,815	I213N	probably damaging	Het
Otog	A	T	7: 46,251,395		probably benign	Het
Pdcd2l	A	T	7: 34,192,807	D212E	possibly damaging	Het
Pex5	T	C	6: 124,404,637	N213S	probably benign	Het
Pkn3	C	T	2: 30,081,134	P238S	probably benign	Het
Prl2b1	A	T	13: 27,390,740		probably null	Het
Ptprb	A	T	10: 116,368,807	I1849L	possibly damaging	Het
Rasal3	G	T	17: 32,393,526	S787Y	probably damaging	Het
Scn2a	T	A	2: 65,701,833	D596E	possibly damaging	Het
Sdhd	A	T	9: 50,603,764	V9D	possibly damaging	Het
Serinc5	T	C	13: 92,708,057	S436P	probably damaging	Het
Slc27a1	C	T	8: 71,584,164	P348L	probably damaging	Het
Smg1	G	A	7: 118,160,383		probably benign	Het
Sorl1	A	T	9: 42,043,900		probably benign	Het
Sprtn	T	A	8: 124,900,218	H112Q	probably damaging	Het
Tet2	A	G	3: 133,467,602	M1633T	probably benign	Het
Tet2	T	A	3: 133,467,725	D1592V	probably benign	Het
Tmem68	A	T	4: 3,569,667	C8S	probably damaging	Het
Tnrc6a	T	A	7: 123,171,816	I943N	probably benign	Het
Trib2	A	T	12: 15,794,068	V191D	probably damaging	Het
Tsc22d4	T	C	5: 137,762,655	S113P	probably damaging	Het
Ttc21b	T	C	2: 66,239,570	R250G	probably damaging	Het
Ubr2	T	C	17: 46,967,248	Y721C	probably damaging	Het
Ubtfl1	A	T	9: 18,409,364	I63F	probably damaging	Het
Ush1c	G	A	7: 46,224,908	P171S	probably benign	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vangl1	A	G	3: 102,166,937	Y285H	probably damaging	Het
Virma	A	G	4: 11,498,769	D70G	probably damaging	Het
Vmn2r102	T	C	17: 19,678,015	F431L	probably benign	Het
Wdr17	A	G	8: 54,661,495	I662T	probably damaging	Het
Wisp2	G	A	2: 163,825,313	C78Y	probably damaging	Het
Zfp160	G	A	17: 21,027,006	R606H	probably benign	Het
Zfp369	C	T	13: 65,296,434	R464C	probably damaging	Het

Other mutations in Apob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Apob	APN	12	7993065	splice site	probably benign
IGL00421:Apob	APN	12	8010197	missense	probably damaging	0.99
IGL00658:Apob	APN	12	8009471	missense	probably benign	0.08
IGL00768:Apob	APN	12	8002107	missense	probably damaging	1.00
IGL00833:Apob	APN	12	8010101	missense	probably benign	0.14
IGL00926:Apob	APN	12	8015421	missense	probably benign	0.01
IGL01065:Apob	APN	12	8003299	missense	probably damaging	0.99
IGL01313:Apob	APN	12	8000898	missense	probably damaging	1.00
IGL01419:Apob	APN	12	8002251	missense	probably damaging	0.99
IGL01461:Apob	APN	12	8001884	missense	probably benign	0.13
IGL02002:Apob	APN	12	7994822	missense	probably benign	0.03
IGL02031:Apob	APN	12	8015222	missense	probably benign
IGL02102:Apob	APN	12	7989407	missense	possibly damaging	0.94
IGL02115:Apob	APN	12	7992923	missense	probably benign	0.06
IGL02513:Apob	APN	12	7992979	missense	probably benign	0.01
IGL02967:Apob	APN	12	8015366	nonsense	probably null
IGL03005:Apob	APN	12	7993059	splice site	probably benign
IGL03011:Apob	APN	12	7997883	missense	probably damaging	1.00
IGL03116:Apob	APN	12	8016350	missense	probably damaging	0.98
IGL03215:Apob	APN	12	8013818	missense	possibly damaging	0.92
IGL03227:Apob	APN	12	8016089	missense	probably benign	0.04
Aesthete	UTSW	12	8010080	nonsense	probably null
Essence	UTSW	12	8007769	nonsense	probably null
Ethos	UTSW	12	7990394	missense	probably null	1.00
IGL02835:Apob	UTSW	12	8015097	missense	possibly damaging	0.86
IGL02837:Apob	UTSW	12	8005102	missense	probably damaging	1.00
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0116:Apob	UTSW	12	7989113	unclassified	probably benign
R0180:Apob	UTSW	12	8008285	nonsense	probably null
R0288:Apob	UTSW	12	7990779	nonsense	probably null
R0295:Apob	UTSW	12	8002181	nonsense	probably null
R0305:Apob	UTSW	12	8012210	missense	probably damaging	1.00
R0312:Apob	UTSW	12	8009034	missense	probably benign
R0324:Apob	UTSW	12	8010521	missense	probably benign	0.41
R0326:Apob	UTSW	12	7990307	missense	probably damaging	1.00
R0363:Apob	UTSW	12	8010136	missense	probably damaging	1.00
R0390:Apob	UTSW	12	7988678	missense	probably damaging	0.99
R0462:Apob	UTSW	12	8000896	missense	probably damaging	1.00
R0471:Apob	UTSW	12	7990406	missense	probably damaging	1.00
R0532:Apob	UTSW	12	8016188	missense	possibly damaging	0.48
R0548:Apob	UTSW	12	8006282	missense	probably damaging	1.00
R0560:Apob	UTSW	12	8005101	missense	probably damaging	1.00
R0595:Apob	UTSW	12	8008369	missense	probably benign	0.01
R0626:Apob	UTSW	12	8016193	missense	probably benign	0.45
R0685:Apob	UTSW	12	8010742	missense	probably benign
R0765:Apob	UTSW	12	8016518	missense	probably benign
R0790:Apob	UTSW	12	8010245	missense	probably damaging	1.00
R0918:Apob	UTSW	12	7983941	missense	probably benign	0.10
R0962:Apob	UTSW	12	7989191	missense	probably damaging	0.98
R1055:Apob	UTSW	12	7994963	missense	probably damaging	1.00
R1077:Apob	UTSW	12	8006017	missense	probably benign
R1143:Apob	UTSW	12	8012354	missense	probably benign	0.26
R1163:Apob	UTSW	12	8011654	missense	probably damaging	1.00
R1266:Apob	UTSW	12	8006093	missense	probably benign	0.37
R1434:Apob	UTSW	12	8009715	missense	probably damaging	1.00
R1442:Apob	UTSW	12	7986165	missense	probably benign	0.31
R1445:Apob	UTSW	12	8016084	missense	possibly damaging	0.48
R1459:Apob	UTSW	12	8006047	missense	probably benign
R1459:Apob	UTSW	12	8011937	missense	possibly damaging	0.92
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1508:Apob	UTSW	12	8011481	missense	possibly damaging	0.92
R1518:Apob	UTSW	12	7989207	missense	probably benign	0.01
R1531:Apob	UTSW	12	7997880	missense	possibly damaging	0.65
R1547:Apob	UTSW	12	8003368	missense	probably benign	0.08
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1682:Apob	UTSW	12	8012365	missense	probably benign	0.00
R1709:Apob	UTSW	12	8009306	missense	probably damaging	0.98
R1718:Apob	UTSW	12	8016087	missense	probably benign	0.02
R1752:Apob	UTSW	12	7988766	missense	probably benign	0.01
R1781:Apob	UTSW	12	8009603	missense	possibly damaging	0.96
R1818:Apob	UTSW	12	8006834	missense	probably damaging	0.98
R1818:Apob	UTSW	12	8013064	missense	possibly damaging	0.93
R1842:Apob	UTSW	12	8011559	missense	probably damaging	1.00
R1843:Apob	UTSW	12	8007602	missense	possibly damaging	0.65
R1853:Apob	UTSW	12	8010928	nonsense	probably null
R1990:Apob	UTSW	12	8001039	missense	probably damaging	1.00
R2016:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2017:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2023:Apob	UTSW	12	8011090	missense	probably benign	0.01
R2037:Apob	UTSW	12	8007488	missense	probably benign	0.37
R2054:Apob	UTSW	12	8013134	missense	probably damaging	1.00
R2057:Apob	UTSW	12	8002164	nonsense	probably null
R2085:Apob	UTSW	12	8012240	missense	probably damaging	1.00
R2159:Apob	UTSW	12	8010081	missense	probably benign	0.12
R2209:Apob	UTSW	12	8007752	missense	probably benign	0.28
R2249:Apob	UTSW	12	8007499	missense	probably damaging	1.00
R2254:Apob	UTSW	12	8011256	missense	possibly damaging	0.92
R2265:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2266:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2267:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2268:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2296:Apob	UTSW	12	7994879	missense	probably damaging	0.97
R2897:Apob	UTSW	12	8010356	missense	probably damaging	1.00
R3431:Apob	UTSW	12	8010778	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8006327	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8011763	missense	possibly damaging	0.46
R3899:Apob	UTSW	12	8015849	missense	possibly damaging	0.87
R4020:Apob	UTSW	12	7994914	nonsense	probably null
R4050:Apob	UTSW	12	8015390	missense	probably benign	0.02
R4351:Apob	UTSW	12	7993054	missense	probably benign	0.03
R4365:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4366:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4456:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4458:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4600:Apob	UTSW	12	8008568	missense	probably damaging	1.00
R4611:Apob	UTSW	12	8011331	missense	probably damaging	1.00
R4646:Apob	UTSW	12	8012759	missense	probably benign	0.21
R4678:Apob	UTSW	12	7995585	missense	probably damaging	1.00
R4685:Apob	UTSW	12	8006456	missense	probably benign	0.00
R4707:Apob	UTSW	12	8006205	missense	probably damaging	0.96
R4726:Apob	UTSW	12	7990267	missense	probably damaging	0.98
R4792:Apob	UTSW	12	8008051	missense	probably benign	0.26
R4822:Apob	UTSW	12	8015741	missense	probably benign	0.04
R4834:Apob	UTSW	12	8014101	missense	possibly damaging	0.49
R4835:Apob	UTSW	12	8015391	missense	possibly damaging	0.56
R4887:Apob	UTSW	12	8013099	missense	probably damaging	1.00
R4910:Apob	UTSW	12	8007848	missense	probably damaging	1.00
R5072:Apob	UTSW	12	8008714	missense	probably benign	0.00
R5073:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5074:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5101:Apob	UTSW	12	8011934	missense	probably benign	0.09
R5123:Apob	UTSW	12	8007630	splice site	probably null
R5133:Apob	UTSW	12	8008898	missense	probably damaging	0.99
R5135:Apob	UTSW	12	8010086	missense	probably damaging	1.00
R5137:Apob	UTSW	12	8011384	missense	possibly damaging	0.63
R5160:Apob	UTSW	12	8012126	missense	possibly damaging	0.90
R5173:Apob	UTSW	12	8008238	missense	probably benign	0.00
R5202:Apob	UTSW	12	8013737	missense	probably damaging	0.98
R5229:Apob	UTSW	12	7977806	missense	probably benign
R5292:Apob	UTSW	12	8005912	missense	probably benign	0.01
R5378:Apob	UTSW	12	8011865	missense	probably damaging	0.99
R5494:Apob	UTSW	12	8011762	missense	probably damaging	0.99
R5517:Apob	UTSW	12	7990906	missense	probably damaging	1.00
R5576:Apob	UTSW	12	7998662	missense	probably damaging	1.00
R5582:Apob	UTSW	12	8010788	missense	probably damaging	1.00
R5629:Apob	UTSW	12	8007847	missense	probably damaging	1.00
R5678:Apob	UTSW	12	7991494	missense	possibly damaging	0.92
R5732:Apob	UTSW	12	8010353	missense	probably benign	0.15
R5734:Apob	UTSW	12	7988781	missense	probably damaging	1.00
R5742:Apob	UTSW	12	8007191	missense	probably damaging	1.00
R5751:Apob	UTSW	12	8012619	nonsense	probably null
R5776:Apob	UTSW	12	8006149	missense	possibly damaging	0.57
R5778:Apob	UTSW	12	8015074	missense	probably benign	0.45
R5783:Apob	UTSW	12	8001022	missense	probably damaging	1.00
R5786:Apob	UTSW	12	8015304	missense	possibly damaging	0.48
R5837:Apob	UTSW	12	8003277	missense	probably benign	0.04
R5857:Apob	UTSW	12	8015397	missense	probably benign	0.00
R6029:Apob	UTSW	12	8016243	missense	probably damaging	0.99
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6086:Apob	UTSW	12	8015164	missense	probably benign
R6110:Apob	UTSW	12	8011883	missense	probably damaging	1.00
R6131:Apob	UTSW	12	8015874	missense	probably benign	0.17
R6157:Apob	UTSW	12	8006077	missense	probably benign
R6179:Apob	UTSW	12	8005060	nonsense	probably null
R6247:Apob	UTSW	12	8001801	missense	probably damaging	1.00
R6279:Apob	UTSW	12	8007769	nonsense	probably null
R6300:Apob	UTSW	12	8007769	nonsense	probably null
R6320:Apob	UTSW	12	7989194	missense	probably benign	0.27
R6339:Apob	UTSW	12	8016188	missense	probably damaging	0.99
R6353:Apob	UTSW	12	8009421	missense	probably damaging	1.00
R6395:Apob	UTSW	12	8008507	missense	probably benign	0.45
R6441:Apob	UTSW	12	7987796	missense	probably damaging	1.00
R6492:Apob	UTSW	12	8008261	missense	probably damaging	0.99
R6495:Apob	UTSW	12	7990394	missense	probably null	1.00
R6502:Apob	UTSW	12	8001814	missense	probably damaging	0.99
R6520:Apob	UTSW	12	7983124	missense	probably damaging	1.00
R6644:Apob	UTSW	12	8009077	missense	probably damaging	0.97
R6704:Apob	UTSW	12	8010379	missense	probably damaging	0.98
R6750:Apob	UTSW	12	7997853	missense	probably damaging	1.00
R6759:Apob	UTSW	12	8011049	missense	probably benign	0.06
R6812:Apob	UTSW	12	7983062	missense	probably damaging	0.98
R6865:Apob	UTSW	12	8008847	missense	probably benign	0.05
R6873:Apob	UTSW	12	8015995	missense	probably benign	0.00
R7013:Apob	UTSW	12	8010080	nonsense	probably null
R7067:Apob	UTSW	12	8009423	missense	probably damaging	1.00
R7084:Apob	UTSW	12	8009591	missense	probably benign
R7113:Apob	UTSW	12	7995539	missense	probably damaging	1.00
R7175:Apob	UTSW	12	8007034	missense	probably benign	0.33
R7196:Apob	UTSW	12	7983893	missense	possibly damaging	0.90
R7199:Apob	UTSW	12	8005072	missense	probably damaging	1.00
R7205:Apob	UTSW	12	8005087	missense	probably damaging	0.98
R7251:Apob	UTSW	12	8007037	missense	probably damaging	0.98
R7474:Apob	UTSW	12	8009185	missense	probably benign	0.29
R7484:Apob	UTSW	12	8006884	nonsense	probably null
R7538:Apob	UTSW	12	8002219	missense	probably damaging	0.98
R7636:Apob	UTSW	12	8009516	missense	possibly damaging	0.86
R7646:Apob	UTSW	12	8009189	missense	probably damaging	0.99
R7787:Apob	UTSW	12	7990780	missense	probably damaging	0.97
R7793:Apob	UTSW	12	8008124	missense	probably damaging	0.99
R7836:Apob	UTSW	12	8001885	missense	possibly damaging	0.72
R7895:Apob	UTSW	12	8011933	missense	probably benign	0.00
R8005:Apob	UTSW	12	8009744	missense	probably benign	0.01
R8013:Apob	UTSW	12	8010798	missense	possibly damaging	0.94
R8014:Apob	UTSW	12	8010798	missense	possibly damaging	0.94
R8111:Apob	UTSW	12	8008801	missense	probably benign	0.16
R8117:Apob	UTSW	12	8006435	missense	probably damaging	0.99
R8226:Apob	UTSW	12	8009056	missense	probably benign	0.00
R8244:Apob	UTSW	12	8010548	missense	probably damaging	0.96
R8280:Apob	UTSW	12	8010851	missense	possibly damaging	0.46
R8310:Apob	UTSW	12	8009033	missense	probably benign	0.00
R8327:Apob	UTSW	12	8001015	missense	possibly damaging	0.72
R8329:Apob	UTSW	12	8011135	missense	probably damaging	0.98
R8331:Apob	UTSW	12	8001882	missense	probably benign	0.28
R8351:Apob	UTSW	12	8006356	missense	probably benign	0.29
R8412:Apob	UTSW	12	8008069	missense	probably benign	0.33
R8425:Apob	UTSW	12	7988842	missense	possibly damaging	0.70
R8481:Apob	UTSW	12	7994807	splice site	probably null
R8493:Apob	UTSW	12	8009009	missense	possibly damaging	0.87
R8529:Apob	UTSW	12	8007353	missense	probably damaging	1.00
R8554:Apob	UTSW	12	7987830	missense	probably damaging	0.98
R8692:Apob	UTSW	12	8008270	missense	probably damaging	0.98
R8695:Apob	UTSW	12	8007830	missense	probably damaging	1.00
R8977:Apob	UTSW	12	8015990	missense	probably damaging	0.99
R9016:Apob	UTSW	12	7985408	splice site	silent
R9020:Apob	UTSW	12	8013999	missense	probably damaging	1.00
R9037:Apob	UTSW	12	8016501	missense	probably benign	0.15
R9053:Apob	UTSW	12	8008954	missense	possibly damaging	0.72
R9062:Apob	UTSW	12	8008046	missense	possibly damaging	0.91
R9142:Apob	UTSW	12	8012705	missense	possibly damaging	0.95
R9180:Apob	UTSW	12	7997925	missense	probably damaging	1.00
R9205:Apob	UTSW	12	7980635	missense	probably damaging	0.99
R9248:Apob	UTSW	12	8015231	nonsense	probably null
R9277:Apob	UTSW	12	8011183	missense	probably benign	0.01
R9305:Apob	UTSW	12	8008053	missense	probably benign	0.04
R9358:Apob	UTSW	12	8010833	missense	probably benign	0.14
R9375:Apob	UTSW	12	7979261	missense	possibly damaging	0.91
R9385:Apob	UTSW	12	8006399	missense	possibly damaging	0.91
R9386:Apob	UTSW	12	8006629	missense	probably damaging	0.99
R9392:Apob	UTSW	12	8007098	missense	probably benign	0.45
R9470:Apob	UTSW	12	7989219	missense	possibly damaging	0.94
R9523:Apob	UTSW	12	8002069	missense	probably damaging	1.00
R9545:Apob	UTSW	12	7983890	missense	possibly damaging	0.81
R9629:Apob	UTSW	12	8009054	missense	probably damaging	1.00
R9702:Apob	UTSW	12	8007559	missense	probably damaging	0.96
R9703:Apob	UTSW	12	7980507	missense	probably damaging	0.99
R9719:Apob	UTSW	12	8015464	missense	probably benign	0.15
R9726:Apob	UTSW	12	8006926	missense	probably damaging	0.99
R9729:Apob	UTSW	12	8016125	missense	probably damaging	0.99
X0027:Apob	UTSW	12	8007975	missense	probably benign
Z1088:Apob	UTSW	12	8005074	missense	possibly damaging	0.91
Z1088:Apob	UTSW	12	8005945	nonsense	probably null
Z1088:Apob	UTSW	12	8012936	missense	possibly damaging	0.95
Z1176:Apob	UTSW	12	7998011	missense	probably damaging	1.00
Z1176:Apob	UTSW	12	8004978	missense	probably benign	0.00
Z1177:Apob	UTSW	12	7988765	missense	probably benign	0.43
Z1177:Apob	UTSW	12	8015249	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCAACAAGCTGGATGTGACCTTCTC -3'
(R):5'- ATCATGGCCTGGTAAATGCTCCCC -3'

Sequencing Primer
(F):5'- GATGTGACCTTCTCTACGCAAAG -3'
(R):5'- TGGTAAATGCTCCCCAGTGAC -3'

Posted On

2013-07-11