Incidental Mutation 'R7141:Appbp2'
ID553352
Institutional Source Beutler Lab
Gene Symbol Appbp2
Ensembl Gene ENSMUSG00000018481
Gene Nameamyloid beta precursor protein (cytoplasmic tail) binding protein 2
SynonymsPAT1, 1300003O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location85187262-85235130 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 85191751 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 551 (Y551*)
Ref Sequence ENSEMBL: ENSMUSP00000018625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018625]
Predicted Effect probably null
Transcript: ENSMUST00000018625
AA Change: Y551*
SMART Domains Protein: ENSMUSP00000018625
Gene: ENSMUSG00000018481
AA Change: Y551*

DomainStartEndE-ValueType
Pfam:TPR_12 395 461 6.5e-13 PFAM
Pfam:TPR_10 428 467 1.1e-9 PFAM
Pfam:TPR_7 432 466 1.2e-5 PFAM
Pfam:TPR_10 470 509 8.9e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Appbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Appbp2 APN 11 85214317 missense possibly damaging 0.86
IGL02112:Appbp2 APN 11 85201620 missense probably benign 0.04
IGL03051:Appbp2 APN 11 85191739 missense possibly damaging 0.90
IGL03068:Appbp2 APN 11 85201420 missense probably damaging 1.00
IGL03260:Appbp2 APN 11 85216457 missense probably benign 0.00
IGL03358:Appbp2 APN 11 85210034 missense probably benign 0.17
R0017:Appbp2 UTSW 11 85214303 missense possibly damaging 0.46
R0267:Appbp2 UTSW 11 85201462 missense probably damaging 1.00
R0504:Appbp2 UTSW 11 85191687 missense probably benign 0.05
R1661:Appbp2 UTSW 11 85210110 critical splice acceptor site probably null
R3438:Appbp2 UTSW 11 85198140 missense probably damaging 1.00
R3817:Appbp2 UTSW 11 85198108 missense probably damaging 1.00
R3950:Appbp2 UTSW 11 85194706 missense probably damaging 1.00
R4273:Appbp2 UTSW 11 85234676 missense probably damaging 1.00
R4574:Appbp2 UTSW 11 85209938 critical splice donor site probably null
R4948:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5322:Appbp2 UTSW 11 85196064 critical splice donor site probably null
R5581:Appbp2 UTSW 11 85210095 missense possibly damaging 0.92
R5593:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5698:Appbp2 UTSW 11 85210099 missense probably damaging 1.00
R7095:Appbp2 UTSW 11 85234727 nonsense probably null
X0058:Appbp2 UTSW 11 85201630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCAATGCAAATGCCAGC -3'
(R):5'- AGAGGGACTGCACCTCTTTC -3'

Sequencing Primer
(F):5'- AGCCCTAAAAACAACATGGTTTG -3'
(R):5'- TCAGCCTGGTATGAATGGCTACAC -3'
Posted On2019-05-15