Incidental Mutation 'R7141:Mtmr4'
ID 553353
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Name myotubularin related protein 4
Synonyms ZFYVE11, FYVE-DSP2, ESTM44, FYVE zinc finger phosphatase
MMRRC Submission 045221-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R7141 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 87482988-87507128 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87491439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 135 (W135R)
Ref Sequence ENSEMBL: ENSMUSP00000099468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628] [ENSMUST00000123105] [ENSMUST00000134216] [ENSMUST00000146871]
AlphaFold Q91XS1
Predicted Effect probably damaging
Transcript: ENSMUST00000092802
AA Change: W135R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: W135R

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103179
AA Change: W135R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: W135R

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119628
AA Change: W135R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: W135R

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123105
Predicted Effect probably damaging
Transcript: ENSMUST00000134216
AA Change: W149R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119660
Gene: ENSMUSG00000018401
AA Change: W149R

DomainStartEndE-ValueType
Pfam:Myotub-related 140 204 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146871
Meta Mutation Damage Score 0.6521 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,323,270 (GRCm39) probably null Het
Abhd10 C T 16: 45,563,169 (GRCm39) R29Q probably benign Het
Adgrv1 A G 13: 81,640,620 (GRCm39) Y3369H probably benign Het
Agl A G 3: 116,546,935 (GRCm39) I1305T probably benign Het
Apba3 A G 10: 81,108,889 (GRCm39) I551V probably damaging Het
Appbp2 A T 11: 85,082,577 (GRCm39) Y551* probably null Het
Btbd17 T C 11: 114,682,641 (GRCm39) N357S possibly damaging Het
Casp2 T C 6: 42,257,329 (GRCm39) F426S possibly damaging Het
Cdh5 A G 8: 104,839,633 (GRCm39) N35D probably benign Het
Cep350 G T 1: 155,790,494 (GRCm39) Q1354K probably damaging Het
Cep44 A G 8: 56,992,886 (GRCm39) C243R probably damaging Het
Chst4 A T 8: 110,757,471 (GRCm39) S131T probably damaging Het
Cox15 T C 19: 43,725,186 (GRCm39) N406D probably benign Het
Cttnbp2 C T 6: 18,380,467 (GRCm39) R1467H probably benign Het
Dock8 A G 19: 25,158,984 (GRCm39) D1714G probably null Het
Erbb2 G T 11: 98,318,135 (GRCm39) R457L probably damaging Het
Esyt3 T C 9: 99,203,493 (GRCm39) N463S probably benign Het
Fam171a1 C T 2: 3,226,189 (GRCm39) Q441* probably null Het
Fam186b T A 15: 99,181,773 (GRCm39) M142L probably benign Het
Git2 G T 5: 114,907,759 (GRCm39) C35* probably null Het
Gm21103 T G 14: 17,482,795 (GRCm39) Q202P probably damaging Het
Gm5622 G T 14: 51,893,339 (GRCm39) E89* probably null Het
Hmcn2 C A 2: 31,250,908 (GRCm39) T790K probably benign Het
Hspg2 T A 4: 137,279,427 (GRCm39) L3114H probably damaging Het
Igkv3-10 A T 6: 70,549,965 (GRCm39) Q37L possibly damaging Het
Kcp G T 6: 29,487,511 (GRCm39) Y1106* probably null Het
Khsrp T C 17: 57,332,602 (GRCm39) D226G possibly damaging Het
Klre1 T A 6: 129,560,129 (GRCm39) W134R probably damaging Het
Lrrc66 A G 5: 73,787,320 (GRCm39) I10T probably benign Het
Map4 T C 9: 109,807,938 (GRCm39) M1T probably null Het
Met T A 6: 17,527,154 (GRCm39) I535K probably benign Het
Mmut T C 17: 41,263,730 (GRCm39) V500A possibly damaging Het
Mrgprb1 A G 7: 48,097,435 (GRCm39) V159A possibly damaging Het
Mrpl41 A G 2: 24,864,468 (GRCm39) L68P probably damaging Het
Myh10 A G 11: 68,692,965 (GRCm39) D1420G probably benign Het
Naglu A C 11: 100,963,056 (GRCm39) D229A probably benign Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Ncln G T 10: 81,323,683 (GRCm39) Y517* probably null Het
Nr1h4 G A 10: 89,334,091 (GRCm39) R100* probably null Het
Or5k1 G A 16: 58,617,771 (GRCm39) T146M probably benign Het
P2rx5 A T 11: 73,051,474 (GRCm39) T18S probably damaging Het
Pclo T C 5: 14,729,271 (GRCm39) S2710P unknown Het
Pdhx A T 2: 102,903,659 (GRCm39) F46I probably benign Het
Piezo2 A T 18: 63,278,181 (GRCm39) L241* probably null Het
Pitpnm1 G A 19: 4,152,787 (GRCm39) V65M probably damaging Het
Rgs3 A G 4: 62,608,724 (GRCm39) D330G probably damaging Het
Scaf8 T C 17: 3,209,457 (GRCm39) V60A unknown Het
Sema4c A G 1: 36,592,101 (GRCm39) Y249H probably damaging Het
Spp2 T C 1: 88,335,050 (GRCm39) Y27H probably damaging Het
Sugct T A 13: 17,819,372 (GRCm39) I158F possibly damaging Het
Sympk A T 7: 18,788,017 (GRCm39) I1178F probably benign Het
Tmppe T C 9: 114,234,036 (GRCm39) Y112H probably benign Het
Trp53bp2 A G 1: 182,276,073 (GRCm39) T187A Het
Tspoap1 A G 11: 87,665,523 (GRCm39) S754G probably damaging Het
Vmn1r214 C T 13: 23,218,839 (GRCm39) A111V probably benign Het
Vmn2r70 G C 7: 85,208,044 (GRCm39) S811C probably benign Het
Zfp638 T C 6: 83,844,181 (GRCm39) S15P unknown Het
Zfp763 A G 17: 33,237,769 (GRCm39) S459P probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87,502,750 (GRCm39) missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87,494,893 (GRCm39) missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87,493,230 (GRCm39) unclassified probably benign
IGL01544:Mtmr4 APN 11 87,488,437 (GRCm39) splice site probably benign
IGL01574:Mtmr4 APN 11 87,491,473 (GRCm39) missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87,494,976 (GRCm39) missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87,491,950 (GRCm39) missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87,505,060 (GRCm39) missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87,491,609 (GRCm39) missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87,488,519 (GRCm39) missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87,502,829 (GRCm39) missense possibly damaging 0.63
Hippie UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
incharge UTSW 11 87,501,868 (GRCm39) nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87,501,953 (GRCm39) missense probably benign
R0009:Mtmr4 UTSW 11 87,502,334 (GRCm39) missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87,489,714 (GRCm39) missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87,501,890 (GRCm39) missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87,502,266 (GRCm39) missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87,503,051 (GRCm39) missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87,504,342 (GRCm39) missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87,493,656 (GRCm39) missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87,502,943 (GRCm39) missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87,495,916 (GRCm39) missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87,501,793 (GRCm39) missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87,491,649 (GRCm39) missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87,495,823 (GRCm39) missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87,494,923 (GRCm39) missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87,501,868 (GRCm39) nonsense probably null
R5502:Mtmr4 UTSW 11 87,504,904 (GRCm39) missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87,495,356 (GRCm39) missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87,495,875 (GRCm39) nonsense probably null
R5907:Mtmr4 UTSW 11 87,502,876 (GRCm39) missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87,494,977 (GRCm39) missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87,501,845 (GRCm39) missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87,504,353 (GRCm39) missense possibly damaging 0.86
R7182:Mtmr4 UTSW 11 87,495,431 (GRCm39) critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87,502,063 (GRCm39) missense probably benign
R7350:Mtmr4 UTSW 11 87,491,476 (GRCm39) missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87,495,383 (GRCm39) missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87,502,727 (GRCm39) missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87,502,702 (GRCm39) missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87,495,406 (GRCm39) missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87,488,550 (GRCm39) missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87,503,015 (GRCm39) missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87,489,690 (GRCm39) missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87,502,756 (GRCm39) nonsense probably null
R8544:Mtmr4 UTSW 11 87,502,735 (GRCm39) missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87,494,950 (GRCm39) missense probably damaging 1.00
R8971:Mtmr4 UTSW 11 87,493,626 (GRCm39) missense probably benign 0.13
R9562:Mtmr4 UTSW 11 87,493,241 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,504,916 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,503,138 (GRCm39) missense probably damaging 1.00
R9797:Mtmr4 UTSW 11 87,494,962 (GRCm39) missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87,502,651 (GRCm39) missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87,502,706 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGGTGTTGATGTCTCCTCCC -3'
(R):5'- TGTCGACATCGGATGTGCTC -3'

Sequencing Primer
(F):5'- GTGTTGTTTACTCTTGACCCCATGG -3'
(R):5'- GATGTGCTCTCCTGCAACACAG -3'
Posted On 2019-05-15