Incidental Mutation 'R7141:Tspoap1'
ID553354
Institutional Source Beutler Lab
Gene Symbol Tspoap1
Ensembl Gene ENSMUSG00000034156
Gene NameTSPO associated protein 1
SynonymsBzrap1, peripheral
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87760541-87785928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87774697 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 754 (S754G)
Ref Sequence ENSEMBL: ENSMUSP00000048063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039627] [ENSMUST00000100644]
Predicted Effect probably damaging
Transcript: ENSMUST00000039627
AA Change: S754G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048063
Gene: ENSMUSG00000034156
AA Change: S754G

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
coiled coil region 219 249 N/A INTRINSIC
low complexity region 301 309 N/A INTRINSIC
coiled coil region 331 519 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
SH3 652 715 1.85e-11 SMART
low complexity region 733 759 N/A INTRINSIC
FN3 784 864 3.14e0 SMART
FN3 878 951 4.81e-4 SMART
FN3 975 1062 7.16e0 SMART
low complexity region 1254 1265 N/A INTRINSIC
low complexity region 1301 1313 N/A INTRINSIC
low complexity region 1387 1401 N/A INTRINSIC
low complexity region 1455 1471 N/A INTRINSIC
SH3 1619 1683 5.4e-13 SMART
low complexity region 1721 1732 N/A INTRINSIC
SH3 1758 1821 5.48e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100644
AA Change: S694G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098209
Gene: ENSMUSG00000034156
AA Change: S694G

DomainStartEndE-ValueType
coiled coil region 121 190 N/A INTRINSIC
low complexity region 241 249 N/A INTRINSIC
coiled coil region 271 459 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
SH3 592 655 1.85e-11 SMART
low complexity region 673 699 N/A INTRINSIC
FN3 724 804 3.14e0 SMART
FN3 818 891 4.81e-4 SMART
FN3 915 1002 7.16e0 SMART
low complexity region 1194 1205 N/A INTRINSIC
low complexity region 1241 1253 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1395 1411 N/A INTRINSIC
SH3 1559 1623 5.4e-13 SMART
low complexity region 1661 1672 N/A INTRINSIC
SH3 1698 1761 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142329
SMART Domains Protein: ENSMUSP00000118819
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
SH3 157 221 5.4e-13 SMART
low complexity region 259 270 N/A INTRINSIC
SH3 296 359 5.48e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144502
SMART Domains Protein: ENSMUSP00000122665
Gene: ENSMUSG00000034156

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
PDB:2CSQ|A 223 250 8e-8 PDB
Blast:SH3 231 251 5e-6 BLAST
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous double-KO with Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Tspoap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Tspoap1 APN 11 87777821 intron probably null
IGL01718:Tspoap1 APN 11 87780255 missense possibly damaging 0.90
IGL02427:Tspoap1 APN 11 87762515 missense probably benign 0.00
IGL02487:Tspoap1 APN 11 87762516 missense possibly damaging 0.90
IGL02730:Tspoap1 APN 11 87781709 missense probably damaging 0.98
IGL02979:Tspoap1 APN 11 87770521 missense probably damaging 1.00
R0384:Tspoap1 UTSW 11 87766454 missense probably damaging 1.00
R0396:Tspoap1 UTSW 11 87776346 splice site probably benign
R0470:Tspoap1 UTSW 11 87776162 missense probably damaging 0.99
R0637:Tspoap1 UTSW 11 87777240 splice site probably benign
R0671:Tspoap1 UTSW 11 87762809 missense probably damaging 1.00
R0960:Tspoap1 UTSW 11 87770595 splice site probably benign
R0989:Tspoap1 UTSW 11 87765823 missense probably damaging 0.99
R1396:Tspoap1 UTSW 11 87766120 missense probably damaging 1.00
R1792:Tspoap1 UTSW 11 87765881 splice site probably null
R2901:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R2902:Tspoap1 UTSW 11 87777975 missense probably benign 0.00
R3969:Tspoap1 UTSW 11 87762446 missense probably damaging 1.00
R4400:Tspoap1 UTSW 11 87775603 missense probably damaging 1.00
R4599:Tspoap1 UTSW 11 87779521 missense probably damaging 1.00
R4635:Tspoap1 UTSW 11 87777857 missense probably benign 0.25
R4731:Tspoap1 UTSW 11 87765647 missense probably benign 0.09
R4755:Tspoap1 UTSW 11 87771663 missense possibly damaging 0.77
R4780:Tspoap1 UTSW 11 87778443 missense possibly damaging 0.48
R4960:Tspoap1 UTSW 11 87766396 nonsense probably null
R5494:Tspoap1 UTSW 11 87775205 missense possibly damaging 0.47
R5687:Tspoap1 UTSW 11 87777126 missense probably damaging 1.00
R6200:Tspoap1 UTSW 11 87761703 missense possibly damaging 0.85
R6563:Tspoap1 UTSW 11 87777159 missense possibly damaging 0.87
R6816:Tspoap1 UTSW 11 87765665 missense probably benign
R6897:Tspoap1 UTSW 11 87765812 missense probably damaging 1.00
R7215:Tspoap1 UTSW 11 87770489 missense probably benign 0.02
R7341:Tspoap1 UTSW 11 87766379 missense probably damaging 1.00
R7360:Tspoap1 UTSW 11 87778521 missense probably benign 0.09
R7394:Tspoap1 UTSW 11 87766119 nonsense probably null
R7483:Tspoap1 UTSW 11 87761525 missense probably benign 0.00
R7617:Tspoap1 UTSW 11 87763625 missense probably benign 0.02
R7793:Tspoap1 UTSW 11 87764310 missense probably benign 0.00
R7814:Tspoap1 UTSW 11 87775524 missense probably damaging 1.00
Z1176:Tspoap1 UTSW 11 87776057 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AGCCATTGAGAAACCGCATG -3'
(R):5'- CGCAGATCTACTCTCTCAGGAG -3'

Sequencing Primer
(F):5'- CTCTGTCAGGGGAGCTCATG -3'
(R):5'- GATCTACTCTCTCAGGAGGCAAC -3'
Posted On2019-05-15