Incidental Mutation 'R7141:Btbd17'
ID 553357
Institutional Source Beutler Lab
Gene Symbol Btbd17
Ensembl Gene ENSMUSG00000000202
Gene Name BTB (POZ) domain containing 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7141 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 114791217-114795945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114791815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 357 (N357S)
Ref Sequence ENSEMBL: ENSMUSP00000000206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000206] [ENSMUST00000084368] [ENSMUST00000138804]
AlphaFold Q9DB72
Predicted Effect possibly damaging
Transcript: ENSMUST00000000206
AA Change: N357S

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000206
Gene: ENSMUSG00000000202
AA Change: N357S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
BTB 63 162 2.01e-11 SMART
BACK 169 269 8.58e-19 SMART
Blast:BACK 425 460 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084368
SMART Domains Protein: ENSMUSP00000081398
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
KISc 9 354 4.53e-150 SMART
coiled coil region 361 388 N/A INTRINSIC
coiled coil region 431 449 N/A INTRINSIC
coiled coil region 506 551 N/A INTRINSIC
low complexity region 628 641 N/A INTRINSIC
low complexity region 750 766 N/A INTRINSIC
low complexity region 807 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138340
SMART Domains Protein: ENSMUSP00000122743
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138804
SMART Domains Protein: ENSMUSP00000115663
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
KISc 9 312 2.99e-118 SMART
coiled coil region 319 346 N/A INTRINSIC
coiled coil region 389 407 N/A INTRINSIC
coiled coil region 464 509 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 683 692 N/A INTRINSIC
Meta Mutation Damage Score 0.2436 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Btbd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Btbd17 APN 11 114795773 missense probably benign 0.00
R1713:Btbd17 UTSW 11 114795824 missense probably benign 0.03
R2072:Btbd17 UTSW 11 114791952 splice site probably null
R2074:Btbd17 UTSW 11 114791952 splice site probably null
R2075:Btbd17 UTSW 11 114791952 splice site probably null
R4461:Btbd17 UTSW 11 114793989 missense possibly damaging 0.83
R4664:Btbd17 UTSW 11 114794006 missense probably damaging 1.00
R4667:Btbd17 UTSW 11 114793857 missense possibly damaging 0.76
R4698:Btbd17 UTSW 11 114791717 missense probably damaging 1.00
R4888:Btbd17 UTSW 11 114794091 missense possibly damaging 0.59
R5250:Btbd17 UTSW 11 114791408 unclassified probably benign
R6572:Btbd17 UTSW 11 114792220 missense probably damaging 1.00
R6592:Btbd17 UTSW 11 114791476 missense probably damaging 1.00
R7215:Btbd17 UTSW 11 114791465 missense possibly damaging 0.67
R7986:Btbd17 UTSW 11 114792515 missense probably damaging 1.00
R9320:Btbd17 UTSW 11 114794084 missense possibly damaging 0.93
R9379:Btbd17 UTSW 11 114791923 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTTCGCTGCTTTGATGGAAG -3'
(R):5'- TGCTGCAGGCTTACCAGTTC -3'

Sequencing Primer
(F):5'- GCTTTGATGGAAGCTGTAGGC -3'
(R):5'- CCGTTGCATTACGCCAAG -3'
Posted On 2019-05-15