Incidental Mutation 'R7141:Fam186b'
ID553364
Institutional Source Beutler Lab
Gene Symbol Fam186b
Ensembl Gene ENSMUSG00000078907
Gene Namefamily with sequence similarity 186, member B
SynonymsEG545136
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99271018-99295888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99283892 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 142 (M142L)
Ref Sequence ENSEMBL: ENSMUSP00000104728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109100] [ENSMUST00000230608]
Predicted Effect probably benign
Transcript: ENSMUST00000109100
AA Change: M142L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104728
Gene: ENSMUSG00000078907
AA Change: M142L

DomainStartEndE-ValueType
Blast:FBG 12 193 1e-19 BLAST
low complexity region 354 363 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 789 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230608
AA Change: M10L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of the FAM186 family, however, its exact function is not known. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Fam186b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Fam186b APN 15 99280318 missense probably benign 0.00
IGL01729:Fam186b APN 15 99280251 missense probably benign 0.02
IGL01948:Fam186b APN 15 99280446 missense probably benign 0.00
IGL02133:Fam186b APN 15 99273703 missense probably damaging 0.96
IGL03010:Fam186b APN 15 99280627 missense possibly damaging 0.80
IGL03371:Fam186b APN 15 99280377 missense probably benign 0.00
R0457:Fam186b UTSW 15 99271285 missense probably benign 0.02
R0522:Fam186b UTSW 15 99280519 missense probably benign 0.00
R0571:Fam186b UTSW 15 99286953 missense probably benign 0.02
R0620:Fam186b UTSW 15 99280128 missense probably benign 0.34
R1575:Fam186b UTSW 15 99286971 missense probably benign 0.00
R1883:Fam186b UTSW 15 99278798 missense probably damaging 0.96
R2144:Fam186b UTSW 15 99280657 missense probably benign 0.00
R2267:Fam186b UTSW 15 99285643 missense probably damaging 0.99
R2332:Fam186b UTSW 15 99280428 missense probably benign 0.42
R2394:Fam186b UTSW 15 99280177 missense probably benign 0.01
R3624:Fam186b UTSW 15 99280515 missense probably benign 0.01
R4681:Fam186b UTSW 15 99280890 missense probably benign 0.00
R4811:Fam186b UTSW 15 99280237 missense probably benign 0.01
R4906:Fam186b UTSW 15 99271321 missense probably damaging 0.99
R5028:Fam186b UTSW 15 99280801 missense probably damaging 0.99
R5047:Fam186b UTSW 15 99280686 missense probably damaging 1.00
R5295:Fam186b UTSW 15 99283874 missense probably damaging 1.00
R5440:Fam186b UTSW 15 99273853 missense possibly damaging 0.75
R5468:Fam186b UTSW 15 99278870 missense possibly damaging 0.93
R5596:Fam186b UTSW 15 99271289 missense possibly damaging 0.90
R5759:Fam186b UTSW 15 99279717 missense probably benign 0.09
R6239:Fam186b UTSW 15 99280434 missense probably benign
R7117:Fam186b UTSW 15 99285590 missense probably damaging 0.98
R7223:Fam186b UTSW 15 99279837 missense possibly damaging 0.77
R7301:Fam186b UTSW 15 99278748 missense probably benign 0.00
R7441:Fam186b UTSW 15 99280089 missense probably benign 0.00
R7614:Fam186b UTSW 15 99286986 missense probably damaging 1.00
R7825:Fam186b UTSW 15 99283847 missense not run
R7853:Fam186b UTSW 15 99280747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGCTTTGTGATCGGCATG -3'
(R):5'- TAGCCAGAGTGCACTGAAAC -3'

Sequencing Primer
(F):5'- ATCGGCATGGCTCGGTTAC -3'
(R):5'- GCCCTCAGGTCTGCTACAC -3'
Posted On2019-05-15