Incidental Mutation 'R7141:Olfr173'
ID553366
Institutional Source Beutler Lab
Gene Symbol Olfr173
Ensembl Gene ENSMUSG00000049362
Gene Nameolfactory receptor 173
SynonymsMOR184-3, GA_x54KRFPKG5P-54960233-54959268
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58795207-58800268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58797408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 146 (T146M)
Ref Sequence ENSEMBL: ENSMUSP00000145946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049940] [ENSMUST00000206205]
Predicted Effect probably benign
Transcript: ENSMUST00000049940
AA Change: T146M

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000052798
Gene: ENSMUSG00000049362
AA Change: T146M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-52 PFAM
Pfam:7tm_1 41 290 9.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206205
AA Change: T146M

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Olfr173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02649:Olfr173 APN 16 58797350 missense probably damaging 1.00
IGL02728:Olfr173 APN 16 58797480 missense probably benign 0.07
IGL02893:Olfr173 APN 16 58797657 missense probably damaging 1.00
R0035:Olfr173 UTSW 16 58797122 nonsense probably null
R0480:Olfr173 UTSW 16 58797321 missense probably benign 0.05
R1101:Olfr173 UTSW 16 58797252 missense probably benign 0.27
R1434:Olfr173 UTSW 16 58797448 missense probably benign 0.06
R1992:Olfr173 UTSW 16 58796946 missense probably benign
R2220:Olfr173 UTSW 16 58797624 missense possibly damaging 0.69
R2436:Olfr173 UTSW 16 58797244 missense probably benign 0.00
R4212:Olfr173 UTSW 16 58797369 missense possibly damaging 0.67
R4910:Olfr173 UTSW 16 58797442 missense probably benign 0.03
R5666:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5670:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5896:Olfr173 UTSW 16 58797732 missense probably damaging 1.00
R6182:Olfr173 UTSW 16 58797292 missense probably damaging 1.00
R6613:Olfr173 UTSW 16 58797531 missense probably damaging 0.99
R6723:Olfr173 UTSW 16 58797432 missense probably benign 0.06
R7051:Olfr173 UTSW 16 58797175 missense probably benign 0.21
R7179:Olfr173 UTSW 16 58796887 missense probably benign 0.00
R7602:Olfr173 UTSW 16 58796980 missense possibly damaging 0.62
Z1176:Olfr173 UTSW 16 58797423 missense probably damaging 1.00
Z1176:Olfr173 UTSW 16 58797673 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAAGACTTGGATTGAGCC -3'
(R):5'- TGCTATTACCCCTAAAATGTTGGAG -3'

Sequencing Primer
(F):5'- CTTGGATTGAGCCTGAAAAGAC -3'
(R):5'- CCCCTAAAATGTTGGAGAACTTTTTC -3'
Posted On2019-05-15