Mutagenetix > Incidental Mutations

Incidental Mutation 'R7141:Scaf8'

553367

Institutional Source

Beutler Lab

Gene Symbol

Scaf8

Ensembl Gene

ENSMUSG00000046201

Gene Name

SR-related CTD-associated factor 8

Synonyms

Rbm16, A630086M08Rik, A930036P18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.849) question?

Stock #

R7141 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3114972-3198859 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3159182 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 60 (V60A)

Ref Sequence

ENSEMBL: ENSMUSP00000076024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076734] [ENSMUST00000232048]

Predicted Effect

unknown
Transcript: ENSMUST00000076734
AA Change: V60A

SMART Domains

Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: V60A

Domain	Start	End	E-Value	Type
RPR	6	136	1.26e-42	SMART
low complexity region	157	171	N/A	INTRINSIC
low complexity region	193	223	N/A	INTRINSIC
low complexity region	232	251	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	397	462	N/A	INTRINSIC
RRM	478	547	9.2e-14	SMART
low complexity region	644	677	N/A	INTRINSIC
low complexity region	685	712	N/A	INTRINSIC
low complexity region	857	883	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC
low complexity region	962	971	N/A	INTRINSIC
low complexity region	1027	1044	N/A	INTRINSIC
internal_repeat_1	1048	1064	2e-5	PROSPERO
internal_repeat_1	1059	1075	2e-5	PROSPERO
low complexity region	1146	1168	N/A	INTRINSIC
low complexity region	1249	1268	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232048
AA Change: V56A

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.7151

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	C	1: 74,284,111		probably null	Het
Abhd10	C	T	16: 45,742,806	R29Q	probably benign	Het
Adgrv1	A	G	13: 81,492,501	Y3369H	probably benign	Het
Agl	A	G	3: 116,753,286	I1305T	probably benign	Het
Apba3	A	G	10: 81,273,055	I551V	probably damaging	Het
Appbp2	A	T	11: 85,191,751	Y551*	probably null	Het
Btbd17	T	C	11: 114,791,815	N357S	possibly damaging	Het
Casp2	T	C	6: 42,280,395	F426S	possibly damaging	Het
Cdh5	A	G	8: 104,113,001	N35D	probably benign	Het
Cep350	G	T	1: 155,914,748	Q1354K	probably damaging	Het
Cep44	A	G	8: 56,539,851	C243R	probably damaging	Het
Chst4	A	T	8: 110,030,839	S131T	probably damaging	Het
Cox15	T	C	19: 43,736,747	N406D	probably benign	Het
Cttnbp2	C	T	6: 18,380,468	R1467H	probably benign	Het
Dock8	A	G	19: 25,181,620	D1714G	probably null	Het
Erbb2	G	T	11: 98,427,309	R457L	probably damaging	Het
Esyt3	T	C	9: 99,321,440	N463S	probably benign	Het
Fam171a1	C	T	2: 3,225,152	Q441*	probably null	Het
Fam186b	T	A	15: 99,283,892	M142L	probably benign	Het
Git2	G	T	5: 114,769,698	C35*	probably null	Het
Gm21103	T	G	14: 6,301,807	Q202P	probably damaging	Het
Gm5622	G	T	14: 51,655,882	E89*	probably null	Het
Hmcn2	C	A	2: 31,360,896	T790K	probably benign	Het
Hspg2	T	A	4: 137,552,116	L3114H	probably damaging	Het
Igkv3-10	A	T	6: 70,572,981	Q37L	possibly damaging	Het
Kcp	G	T	6: 29,487,512	Y1106*	probably null	Het
Khsrp	T	C	17: 57,025,602	D226G	possibly damaging	Het
Klre1	T	A	6: 129,583,166	W134R	probably damaging	Het
Lrrc66	A	G	5: 73,629,977	I10T	probably benign	Het
Map4	T	C	9: 109,978,870	M1T	probably null	Het
Met	T	A	6: 17,527,155	I535K	probably benign	Het
Mrgprb1	A	G	7: 48,447,687	V159A	possibly damaging	Het
Mrpl41	A	G	2: 24,974,456	L68P	probably damaging	Het
Mtmr4	T	C	11: 87,600,613	W135R	probably damaging	Het
Mut	T	C	17: 40,952,839	V500A	possibly damaging	Het
Myh10	A	G	11: 68,802,139	D1420G	probably benign	Het
Naglu	A	C	11: 101,072,230	D229A	probably benign	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Ncln	G	T	10: 81,487,849	Y517*	probably null	Het
Nr1h4	G	A	10: 89,498,229	R100*	probably null	Het
Olfr173	G	A	16: 58,797,408	T146M	probably benign	Het
P2rx5	A	T	11: 73,160,648	T18S	probably damaging	Het
Pclo	T	C	5: 14,679,257	S2710P	unknown	Het
Pdhx	A	T	2: 103,073,314	F46I	probably benign	Het
Piezo2	A	T	18: 63,145,110	L241*	probably null	Het
Pitpnm1	G	A	19: 4,102,787	V65M	probably damaging	Het
Rgs3	A	G	4: 62,690,487	D330G	probably damaging	Het
Sema4c	A	G	1: 36,553,020	Y249H	probably damaging	Het
Spp2	T	C	1: 88,407,328	Y27H	probably damaging	Het
Sugct	T	A	13: 17,644,787	I158F	possibly damaging	Het
Sympk	A	T	7: 19,054,092	I1178F	probably benign	Het
Tmppe	T	C	9: 114,404,968	Y112H	probably benign	Het
Trp53bp2	A	G	1: 182,448,508	T187A		Het
Tspoap1	A	G	11: 87,774,697	S754G	probably damaging	Het
Vmn1r214	C	T	13: 23,034,669	A111V	probably benign	Het
Vmn2r70	G	C	7: 85,558,836	S811C	probably benign	Het
Zfp638	T	C	6: 83,867,199	S15P	unknown	Het
Zfp763	A	G	17: 33,018,795	S459P	probably damaging	Het

Other mutations in Scaf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Scaf8	APN	17	3171134	missense	unknown
IGL00956:Scaf8	APN	17	3171147	missense	unknown
IGL01610:Scaf8	APN	17	3195849	missense	probably damaging	1.00
IGL01967:Scaf8	APN	17	3196938	missense	possibly damaging	0.91
IGL02005:Scaf8	APN	17	3185870	missense	probably damaging	1.00
IGL03037:Scaf8	APN	17	3190221	missense	probably damaging	0.99
BB004:Scaf8	UTSW	17	3159220	missense	unknown
BB014:Scaf8	UTSW	17	3159220	missense	unknown
R0320:Scaf8	UTSW	17	3178255	missense	unknown
R0789:Scaf8	UTSW	17	3196837	missense	possibly damaging	0.94
R0850:Scaf8	UTSW	17	3195774	splice site	probably null
R0919:Scaf8	UTSW	17	3197120	missense	probably damaging	1.00
R1488:Scaf8	UTSW	17	3197597	missense	probably damaging	0.97
R1544:Scaf8	UTSW	17	3145154	missense	probably damaging	0.96
R1928:Scaf8	UTSW	17	3168077	missense	unknown
R1972:Scaf8	UTSW	17	3169371	missense	unknown
R2156:Scaf8	UTSW	17	3164132	splice site	probably null
R2164:Scaf8	UTSW	17	3197210	missense	probably damaging	1.00
R2680:Scaf8	UTSW	17	3197591	missense	possibly damaging	0.95
R3794:Scaf8	UTSW	17	3190249	missense	probably damaging	1.00
R4368:Scaf8	UTSW	17	3171195	missense	unknown
R4673:Scaf8	UTSW	17	3197985	missense	probably benign	0.04
R4694:Scaf8	UTSW	17	3197404	missense	probably damaging	1.00
R4716:Scaf8	UTSW	17	3177123	missense	unknown
R4852:Scaf8	UTSW	17	3178219	missense	unknown
R5036:Scaf8	UTSW	17	3164262	unclassified	probably benign
R5193:Scaf8	UTSW	17	3190165	missense	probably benign	0.02
R5429:Scaf8	UTSW	17	3197110	missense	probably benign	0.14
R5816:Scaf8	UTSW	17	3177713	missense	unknown
R6050:Scaf8	UTSW	17	3168108	missense	unknown
R6493:Scaf8	UTSW	17	3171119	missense	unknown
R6616:Scaf8	UTSW	17	3168055	missense	unknown
R7065:Scaf8	UTSW	17	3159211	missense	probably damaging	1.00
R7112:Scaf8	UTSW	17	3163029	missense	unknown
R7198:Scaf8	UTSW	17	3163098	missense	unknown
R7265:Scaf8	UTSW	17	3177625	missense	unknown
R7592:Scaf8	UTSW	17	3171222	critical splice donor site	probably null
R7711:Scaf8	UTSW	17	3187634	missense	probably damaging	0.97
R7813:Scaf8	UTSW	17	3197274	missense	probably damaging	1.00
R7867:Scaf8	UTSW	17	3177719	missense	unknown
R7927:Scaf8	UTSW	17	3159220	missense	unknown
R7937:Scaf8	UTSW	17	3197207	missense	probably damaging	0.99
R7958:Scaf8	UTSW	17	3171122	missense	unknown
R7960:Scaf8	UTSW	17	3171122	missense	unknown
R8024:Scaf8	UTSW	17	3159293	missense	unknown
R8118:Scaf8	UTSW	17	3164183	missense	unknown
R8285:Scaf8	UTSW	17	3177129	missense	unknown
R8303:Scaf8	UTSW	17	3148552	missense	unknown
R8365:Scaf8	UTSW	17	3195966	missense	possibly damaging	0.67
R8544:Scaf8	UTSW	17	3163020	unclassified	probably benign
Z1088:Scaf8	UTSW	17	3162983	unclassified	probably benign
Z1177:Scaf8	UTSW	17	3162994	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCTAGTTTGGAACTTGGGTAAGTAAC -3'
(R):5'- AAAGGCTCTGAGAGTAACATACCTC -3'

Sequencing Primer
(F):5'- TGATCTGAATGCATTGAATAGCC -3'
(R):5'- CCCAGGGCAACGATATAA -3'

Posted On

2019-05-15