Incidental Mutation 'R7141:Scaf8'
ID553367
Institutional Source Beutler Lab
Gene Symbol Scaf8
Ensembl Gene ENSMUSG00000046201
Gene NameSR-related CTD-associated factor 8
SynonymsRbm16, A630086M08Rik, A930036P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location3114972-3198859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3159182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 60 (V60A)
Ref Sequence ENSEMBL: ENSMUSP00000076024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076734] [ENSMUST00000232048]
Predicted Effect unknown
Transcript: ENSMUST00000076734
AA Change: V60A
SMART Domains Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: V60A

DomainStartEndE-ValueType
RPR 6 136 1.26e-42 SMART
low complexity region 157 171 N/A INTRINSIC
low complexity region 193 223 N/A INTRINSIC
low complexity region 232 251 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 397 462 N/A INTRINSIC
RRM 478 547 9.2e-14 SMART
low complexity region 644 677 N/A INTRINSIC
low complexity region 685 712 N/A INTRINSIC
low complexity region 857 883 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
low complexity region 962 971 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
internal_repeat_1 1048 1064 2e-5 PROSPERO
internal_repeat_1 1059 1075 2e-5 PROSPERO
low complexity region 1146 1168 N/A INTRINSIC
low complexity region 1249 1268 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000232048
AA Change: V56A

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.7151 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Scaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Scaf8 APN 17 3171134 missense unknown
IGL00956:Scaf8 APN 17 3171147 missense unknown
IGL01610:Scaf8 APN 17 3195849 missense probably damaging 1.00
IGL01967:Scaf8 APN 17 3196938 missense possibly damaging 0.91
IGL02005:Scaf8 APN 17 3185870 missense probably damaging 1.00
IGL03037:Scaf8 APN 17 3190221 missense probably damaging 0.99
R0320:Scaf8 UTSW 17 3178255 missense unknown
R0789:Scaf8 UTSW 17 3196837 missense possibly damaging 0.94
R0850:Scaf8 UTSW 17 3195774 splice site probably null
R0919:Scaf8 UTSW 17 3197120 missense probably damaging 1.00
R1488:Scaf8 UTSW 17 3197597 missense probably damaging 0.97
R1544:Scaf8 UTSW 17 3145154 missense probably damaging 0.96
R1928:Scaf8 UTSW 17 3168077 missense unknown
R1972:Scaf8 UTSW 17 3169371 missense unknown
R2156:Scaf8 UTSW 17 3164132 splice site probably null
R2164:Scaf8 UTSW 17 3197210 missense probably damaging 1.00
R2680:Scaf8 UTSW 17 3197591 missense possibly damaging 0.95
R3794:Scaf8 UTSW 17 3190249 missense probably damaging 1.00
R4368:Scaf8 UTSW 17 3171195 missense unknown
R4673:Scaf8 UTSW 17 3197985 missense probably benign 0.04
R4694:Scaf8 UTSW 17 3197404 missense probably damaging 1.00
R4716:Scaf8 UTSW 17 3177123 missense unknown
R4852:Scaf8 UTSW 17 3178219 missense unknown
R5036:Scaf8 UTSW 17 3164262 unclassified probably benign
R5193:Scaf8 UTSW 17 3190165 missense probably benign 0.02
R5429:Scaf8 UTSW 17 3197110 missense probably benign 0.14
R5816:Scaf8 UTSW 17 3177713 missense unknown
R6050:Scaf8 UTSW 17 3168108 missense unknown
R6493:Scaf8 UTSW 17 3171119 missense unknown
R6616:Scaf8 UTSW 17 3168055 missense unknown
R7065:Scaf8 UTSW 17 3159211 missense probably damaging 1.00
R7112:Scaf8 UTSW 17 3163029 missense unknown
R7198:Scaf8 UTSW 17 3163098 missense unknown
R7265:Scaf8 UTSW 17 3177625 missense unknown
R7592:Scaf8 UTSW 17 3171222 critical splice donor site probably null
R7711:Scaf8 UTSW 17 3187634 missense probably damaging 0.97
R7813:Scaf8 UTSW 17 3197274 missense probably damaging 1.00
Z1088:Scaf8 UTSW 17 3162983 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTAGTTTGGAACTTGGGTAAGTAAC -3'
(R):5'- AAAGGCTCTGAGAGTAACATACCTC -3'

Sequencing Primer
(F):5'- TGATCTGAATGCATTGAATAGCC -3'
(R):5'- CCCAGGGCAACGATATAA -3'
Posted On2019-05-15