Incidental Mutation 'R7141:Pitpnm1'
ID553372
Institutional Source Beutler Lab
Gene Symbol Pitpnm1
Ensembl Gene ENSMUSG00000024851
Gene Namephosphatidylinositol transfer protein, membrane-associated 1
SynonymsDRES9, RdgB
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4099998-4113965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4102787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 65 (V65M)
Ref Sequence ENSEMBL: ENSMUSP00000054309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025779] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000131265] [ENSMUST00000174149] [ENSMUST00000174514] [ENSMUST00000174799]
Predicted Effect probably benign
Transcript: ENSMUST00000025779
SMART Domains Protein: ENSMUSP00000025779
Gene: ENSMUSG00000024856

DomainStartEndE-ValueType
low complexity region 7 44 N/A INTRINSIC
Pfam:CDK2AP 58 126 1.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049658
AA Change: V65M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851
AA Change: V65M

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 2e-145 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100022
AA Change: V65M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851
AA Change: V65M

DomainStartEndE-ValueType
Pfam:IP_trans 1 250 1.6e-113 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131265
AA Change: V65M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120563
Gene: ENSMUSG00000024851
AA Change: V65M

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 5e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174149
SMART Domains Protein: ENSMUSP00000134613
Gene: ENSMUSG00000024856

DomainStartEndE-ValueType
low complexity region 7 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174514
SMART Domains Protein: ENSMUSP00000134093
Gene: ENSMUSG00000024856

DomainStartEndE-ValueType
Pfam:CDK2AP 30 107 8.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174799
SMART Domains Protein: ENSMUSP00000133593
Gene: ENSMUSG00000024856

DomainStartEndE-ValueType
low complexity region 7 44 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male-specific decrease in circulating cholesterol and circulating calcium levels and female-specific decreased leukocyte cell numbers and a slight increase in auditory brainstem response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Pitpnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pitpnm1 APN 19 4110665 splice site probably null
IGL00978:Pitpnm1 APN 19 4101228 missense possibly damaging 0.61
IGL02039:Pitpnm1 APN 19 4105032 missense probably benign 0.01
IGL02122:Pitpnm1 APN 19 4107796 missense probably damaging 1.00
IGL02279:Pitpnm1 APN 19 4101207 missense probably damaging 1.00
IGL02316:Pitpnm1 APN 19 4112835 missense probably benign 0.16
IGL02434:Pitpnm1 APN 19 4103377 missense probably benign 0.00
R0926:Pitpnm1 UTSW 19 4112338 missense probably damaging 1.00
R1301:Pitpnm1 UTSW 19 4110831 splice site probably null
R1423:Pitpnm1 UTSW 19 4112392 missense probably damaging 1.00
R1592:Pitpnm1 UTSW 19 4106964 critical splice donor site probably null
R1733:Pitpnm1 UTSW 19 4109960 nonsense probably null
R1844:Pitpnm1 UTSW 19 4112395 missense probably damaging 1.00
R1971:Pitpnm1 UTSW 19 4112450 missense probably damaging 1.00
R1978:Pitpnm1 UTSW 19 4107973 unclassified probably null
R2016:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2017:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2019:Pitpnm1 UTSW 19 4113641 missense probably damaging 1.00
R2210:Pitpnm1 UTSW 19 4105253 missense probably damaging 1.00
R2393:Pitpnm1 UTSW 19 4110935 missense probably benign 0.02
R3434:Pitpnm1 UTSW 19 4112234 missense probably damaging 1.00
R3439:Pitpnm1 UTSW 19 4112752 missense probably benign 0.00
R4554:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4555:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4557:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4831:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R4874:Pitpnm1 UTSW 19 4112252 critical splice donor site probably null
R5058:Pitpnm1 UTSW 19 4112758 missense probably benign 0.00
R5069:Pitpnm1 UTSW 19 4111140 missense probably benign 0.44
R5249:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R5288:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5385:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5619:Pitpnm1 UTSW 19 4103270 missense probably damaging 1.00
R5650:Pitpnm1 UTSW 19 4103319 missense possibly damaging 0.78
R6267:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6341:Pitpnm1 UTSW 19 4102829 nonsense probably null
R6608:Pitpnm1 UTSW 19 4110875 missense probably damaging 1.00
R6739:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6915:Pitpnm1 UTSW 19 4106947 missense possibly damaging 0.95
R7751:Pitpnm1 UTSW 19 4103470 missense probably benign 0.02
R8057:Pitpnm1 UTSW 19 4112145 missense probably null 0.71
Z1177:Pitpnm1 UTSW 19 4105009 missense probably benign
Z1177:Pitpnm1 UTSW 19 4109996 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGAATTAGAACCAACCTGAG -3'
(R):5'- AACTTCTCCACAAAGGGGC -3'

Sequencing Primer
(F):5'- TGAGGACCCCAGAATTTAAGC -3'
(R):5'- TTCTCCACAAAGGGGCAGGTG -3'
Posted On2019-05-15