Incidental Mutation 'R7141:Cox15'
ID553374
Institutional Source Beutler Lab
Gene Symbol Cox15
Ensembl Gene ENSMUSG00000040018
Gene Namecytochrome c oxidase assembly protein 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location43733254-43753000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43736747 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 406 (N406D)
Ref Sequence ENSEMBL: ENSMUSP00000041820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045562] [ENSMUST00000081079]
Predicted Effect probably benign
Transcript: ENSMUST00000045562
AA Change: N406D

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041820
Gene: ENSMUSG00000040018
AA Change: N406D

DomainStartEndE-ValueType
Pfam:COX15-CtaA 73 402 2.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081079
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be essential for the biogenesis of COX formation and may function in the hydroxylation of heme O, according to the yeast mutant studies. This protein is predicted to contain 5 transmembrane domains localized in the mitochondrial inner membrane. Alternative splicing of this gene generates two transcript variants diverging in the 3' region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A C 1: 74,284,111 probably null Het
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Cox15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cox15 APN 19 43743665 nonsense probably null
R0122:Cox15 UTSW 19 43748790 missense possibly damaging 0.56
R1452:Cox15 UTSW 19 43746905 missense probably damaging 1.00
R1931:Cox15 UTSW 19 43746785 missense probably benign 0.01
R1932:Cox15 UTSW 19 43746785 missense probably benign 0.01
R6268:Cox15 UTSW 19 43739926 missense possibly damaging 0.88
R6720:Cox15 UTSW 19 43736789 missense probably damaging 1.00
R7743:Cox15 UTSW 19 43739941 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TAATGTTCGTGGTCCAGTGCC -3'
(R):5'- TTGCTTCTGACATGGGGTAC -3'

Sequencing Primer
(F):5'- GTGCCCATCTCAGAACAGTTC -3'
(R):5'- GTACATGCATTTGTAATGTCTGAGAG -3'
Posted On2019-05-15