Mutagenetix > Incidental Mutations

Incidental Mutation 'R7140:Speg'

553375

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7140 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 75406770 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]

Predicted Effect

probably null
Transcript: ENSMUST00000087122

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000087122

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113587

SMART Domains

Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113588

SMART Domains

Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113589

SMART Domains

Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113590

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122266

SMART Domains

Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000137868

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra2	T	C	8: 27,120,901		probably null	Het
Ap2a2	G	A	7: 141,598,864	A148T	probably benign	Het
Arhgef3	A	T	14: 27,401,707	N442Y	probably damaging	Het
B3gat3	A	G	19: 8,925,852	Y191C	probably damaging	Het
B430306N03Rik	A	T	17: 48,322,455	K203*	probably null	Het
C1qtnf6	T	A	15: 78,525,083	Y188F	probably benign	Het
Capn10	T	C	1: 92,945,271	V573A	possibly damaging	Het
Cbx4	T	C	11: 119,081,928	Y207C	probably damaging	Het
Ccdc43	G	T	11: 102,688,869		probably null	Het
Ccng2	C	A	5: 93,268,755	P45Q	probably benign	Het
Cd86	T	C	16: 36,620,901	H68R	probably benign	Het
Cmtm4	A	G	8: 104,355,195	Y187H	probably damaging	Het
Cst11	T	C	2: 148,768,729	N134S	probably benign	Het
Cyp3a25	A	T	5: 146,003,045	F51I	probably benign	Het
Dnhd1	A	G	7: 105,693,766	E1439G	probably benign	Het
Dock4	T	C	12: 40,636,159	V131A	probably benign	Het
Dpysl2	A	G	14: 66,862,533	S85P	probably benign	Het
Dync1i2	A	G	2: 71,247,939	H324R	probably benign	Het
Elf1	A	G	14: 79,567,270	D162G	probably benign	Het
Eri3	G	A	4: 117,649,407		probably null	Het
Fbxl21	T	C	13: 56,532,332	S203P	probably damaging	Het
Foxi1	G	A	11: 34,205,758	R291C	probably damaging	Het
Gm13089	T	G	4: 143,698,432	H147P	probably benign	Het
Gprin3	C	T	6: 59,355,143	A60T	possibly damaging	Het
Hecw1	A	G	13: 14,316,533	C212R	probably benign	Het
Hivep3	T	C	4: 120,097,121	L878P	probably damaging	Het
Hs6st3	A	T	14: 119,139,102	N230Y	probably damaging	Het
Htr3b	A	G	9: 48,937,141	V268A	possibly damaging	Het
Ip6k3	T	C	17: 27,144,995	T360A	probably damaging	Het
Izumo1	A	G	7: 45,626,112	T282A	probably benign	Het
Kidins220	T	A	12: 25,036,624	I1019N	probably damaging	Het
Med13l	T	C	5: 118,741,972	V1043A	probably benign	Het
Mon2	C	T	10: 123,035,453	V420I	probably benign	Het
Naip6	T	A	13: 100,300,200	Y605F	possibly damaging	Het
Nek7	A	G	1: 138,487,055	I285T	probably benign	Het
Notch3	A	G	17: 32,156,377	V357A	possibly damaging	Het
Nrxn1	G	A	17: 91,088,764		probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1009	T	A	2: 85,721,474	L23Q	probably damaging	Het
Olfr1200	G	A	2: 88,767,964	A117V	probably damaging	Het
Olfr1362	C	T	13: 21,611,127	V281M	possibly damaging	Het
Olfr821	T	G	10: 130,034,214	M196R	possibly damaging	Het
Ostm1	C	T	10: 42,683,272	A176V	probably null	Het
Pabpc6	C	A	17: 9,668,428	S398I	possibly damaging	Het
Pcdhac2	C	A	18: 37,144,186	P73H	possibly damaging	Het
Pcdhga9	A	G	18: 37,739,131	D671G	possibly damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pigu	A	C	2: 155,301,240	L248R	possibly damaging	Het
Pinx1	C	A	14: 63,860,385		probably null	Het
Pon3	T	C	6: 5,221,664	N322S	possibly damaging	Het
Rnft1	A	G	11: 86,491,760	I270V	probably benign	Het
Scgb2b11	A	G	7: 32,210,581	F27L	probably damaging	Het
Slc5a4b	C	T	10: 76,075,109	V298I	probably damaging	Het
Slco1a6	T	A	6: 142,103,019	H345L	probably benign	Het
Sox1	C	T	8: 12,397,405	P349S	possibly damaging	Het
Spata31	A	G	13: 64,921,099	N354D	probably benign	Het
Stpg1	T	C	4: 135,533,722	I281T	probably benign	Het
Sult3a1	T	C	10: 33,877,287	L193P	probably damaging	Het
Tenm3	A	T	8: 48,292,236	C1097S	probably damaging	Het
Tfap2a	A	G	13: 40,730,047	S7P	probably benign	Het
Tlr1	T	C	5: 64,925,678	I519V	probably benign	Het
Tmem238	A	G	7: 4,789,073	V157A	possibly damaging	Het
Tmem45b	A	T	9: 31,434,484		probably null	Het
Togaram2	A	T	17: 71,714,766	H742L	probably benign	Het
Trpc7	A	T	13: 56,789,674	Y656*	probably null	Het
Wdr35	T	A	12: 9,022,785	Y920N	probably damaging	Het
Xab2	G	A	8: 3,618,117	R154C	possibly damaging	Het
Zfp759	A	T	13: 67,140,113	H576L	possibly damaging	Het
Zfp958	G	T	8: 4,628,481	A169S	probably benign	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGTGAATGAGGGTGACAACTTG -3'
(R):5'- GTCCCACTTCCAGATCTTGCAG -3'

Sequencing Primer
(F):5'- CAACTTGCGGCTTCAACAGGATG -3'
(R):5'- GTCAGGAATAGACAGCCTCTCTAG -3'

Posted On

2019-05-15