Incidental Mutation 'R7140:Speg'
ID 553375
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7140 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75375297-75432320 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 75406770 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000087122
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087122
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113587
SMART Domains Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113588
SMART Domains Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113589
SMART Domains Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113590
SMART Domains Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 186 212 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 253 262 N/A INTRINSIC
low complexity region 306 317 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
IGc2 633 700 2.19e-9 SMART
low complexity region 752 764 N/A INTRINSIC
IGc2 780 848 4.03e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122266
SMART Domains Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
IGc2 32 100 4.03e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137868
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8781:Speg UTSW 1 75407021 missense probably damaging 1.00
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
R8898:Speg UTSW 1 75388873 missense probably damaging 1.00
R8935:Speg UTSW 1 75422606 missense probably benign 0.30
R9019:Speg UTSW 1 75429238 missense probably damaging 1.00
R9027:Speg UTSW 1 75388432 missense possibly damaging 0.67
R9066:Speg UTSW 1 75385010 missense probably damaging 0.99
R9092:Speg UTSW 1 75422734 missense probably benign 0.01
R9117:Speg UTSW 1 75387800 missense probably damaging 1.00
R9202:Speg UTSW 1 75390993 missense probably damaging 1.00
R9246:Speg UTSW 1 75384854 missense probably damaging 1.00
R9248:Speg UTSW 1 75421776 missense probably damaging 1.00
R9451:Speg UTSW 1 75417733 missense probably damaging 1.00
R9452:Speg UTSW 1 75422508 missense probably benign
R9475:Speg UTSW 1 75388091 missense probably damaging 1.00
R9476:Speg UTSW 1 75401124 missense probably damaging 0.99
R9510:Speg UTSW 1 75401124 missense probably damaging 0.99
R9519:Speg UTSW 1 75415736 missense probably damaging 1.00
R9528:Speg UTSW 1 75387803 missense possibly damaging 0.78
R9542:Speg UTSW 1 75422782 missense probably benign 0.08
R9553:Speg UTSW 1 75418001 missense probably benign 0.00
R9767:Speg UTSW 1 75427181 missense possibly damaging 0.78
R9768:Speg UTSW 1 75418973 nonsense probably null
R9800:Speg UTSW 1 75422714 missense probably benign 0.03
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGAATGAGGGTGACAACTTG -3'
(R):5'- GTCCCACTTCCAGATCTTGCAG -3'

Sequencing Primer
(F):5'- CAACTTGCGGCTTCAACAGGATG -3'
(R):5'- GTCAGGAATAGACAGCCTCTCTAG -3'
Posted On 2019-05-15