Incidental Mutation 'R7140:Cst11'
ID553382
Institutional Source Beutler Lab
Gene Symbol Cst11
Ensembl Gene ENSMUSG00000036958
Gene Namecystatin 11
SynonymsmCST E1, 9230101F08Rik, CRES2, cystatin E1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location148768609-148771497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148768729 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 134 (N134S)
Ref Sequence ENSEMBL: ENSMUSP00000028934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028934]
Predicted Effect probably benign
Transcript: ENSMUST00000028934
AA Change: N134S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028934
Gene: ENSMUSG00000036958
AA Change: N134S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 32 136 2.24e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes an epididymal-specific protein shown to have antimicrobial activity against E. coli. Alternative splicing yields two variants encoding distinct isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Cst11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Cst11 APN 2 148771241 missense probably damaging 1.00
R0020:Cst11 UTSW 2 148771333 missense probably damaging 0.97
R0020:Cst11 UTSW 2 148771333 missense probably damaging 0.97
R0060:Cst11 UTSW 2 148770402 missense probably damaging 1.00
R0988:Cst11 UTSW 2 148770426 missense probably benign 0.26
R2102:Cst11 UTSW 2 148771240 missense probably damaging 1.00
R4042:Cst11 UTSW 2 148771280 missense probably benign 0.00
R5008:Cst11 UTSW 2 148770405 missense probably benign 0.24
R5768:Cst11 UTSW 2 148770467 nonsense probably null
R7841:Cst11 UTSW 2 148771307 missense possibly damaging 0.93
R7924:Cst11 UTSW 2 148771307 missense possibly damaging 0.93
X0024:Cst11 UTSW 2 148770460 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTGGAACTCCTAGTAGACCTCC -3'
(R):5'- AGCCTCAGGTTTGATGTTCTC -3'

Sequencing Primer
(F):5'- AACTCCTAGTAGACCTCCACATTTTC -3'
(R):5'- ACGAGTCTAACTATGGAGCCCATTTC -3'
Posted On2019-05-15