Incidental Mutation 'R7140:Gm13089'
ID553387
Institutional Source Beutler Lab
Gene Symbol Gm13089
Ensembl Gene ENSMUSG00000070617
Gene Namepredicted gene 13089
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143696500-143702711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 143698432 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 147 (H147P)
Ref Sequence ENSEMBL: ENSMUSP00000073224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073532]
Predicted Effect probably benign
Transcript: ENSMUST00000073532
AA Change: H147P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000073224
Gene: ENSMUSG00000070617
AA Change: H147P

DomainStartEndE-ValueType
low complexity region 204 216 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Gm13089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Gm13089 APN 4 143696840 utr 3 prime probably benign
IGL02087:Gm13089 APN 4 143697074 missense probably damaging 0.96
IGL02296:Gm13089 APN 4 143698481 nonsense probably null
IGL02902:Gm13089 APN 4 143698343 missense probably damaging 1.00
IGL02903:Gm13089 APN 4 143699166 missense probably benign 0.04
IGL02962:Gm13089 APN 4 143697340 missense probably benign 0.28
IGL03351:Gm13089 APN 4 143697088 missense possibly damaging 0.80
R0122:Gm13089 UTSW 4 143698404 missense probably benign 0.44
R0533:Gm13089 UTSW 4 143698020 nonsense probably null
R0609:Gm13089 UTSW 4 143698503 missense probably benign 0.00
R0743:Gm13089 UTSW 4 143698564 missense probably damaging 0.97
R0744:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R0833:Gm13089 UTSW 4 143698486 missense probably benign 0.19
R1052:Gm13089 UTSW 4 143696907 missense possibly damaging 0.81
R1690:Gm13089 UTSW 4 143698123 missense probably benign 0.03
R1764:Gm13089 UTSW 4 143698270 missense probably benign 0.14
R1896:Gm13089 UTSW 4 143698144 missense probably benign 0.11
R2084:Gm13089 UTSW 4 143699350 missense probably damaging 1.00
R2178:Gm13089 UTSW 4 143698042 missense possibly damaging 0.95
R2888:Gm13089 UTSW 4 143696890 missense probably benign 0.00
R3759:Gm13089 UTSW 4 143697151 missense probably damaging 1.00
R4193:Gm13089 UTSW 4 143698333 missense probably damaging 1.00
R4380:Gm13089 UTSW 4 143698286 missense probably benign 0.21
R4385:Gm13089 UTSW 4 143698014 critical splice donor site probably null
R4513:Gm13089 UTSW 4 143698148 missense probably benign 0.00
R4647:Gm13089 UTSW 4 143699344 missense probably benign 0.00
R4920:Gm13089 UTSW 4 143699283 missense probably benign 0.05
R4994:Gm13089 UTSW 4 143698369 missense possibly damaging 0.94
R5197:Gm13089 UTSW 4 143698062 missense possibly damaging 0.86
R6005:Gm13089 UTSW 4 143698432 missense probably benign 0.00
R6073:Gm13089 UTSW 4 143698268 missense probably damaging 0.99
R6197:Gm13089 UTSW 4 143697316 missense possibly damaging 0.90
R6264:Gm13089 UTSW 4 143699152 missense possibly damaging 0.50
R6821:Gm13089 UTSW 4 143699304 nonsense probably null
R6923:Gm13089 UTSW 4 143699106 missense probably benign 0.06
R7034:Gm13089 UTSW 4 143697328 missense probably damaging 1.00
R7298:Gm13089 UTSW 4 143698505 missense probably benign 0.23
R7529:Gm13089 UTSW 4 143702674
R7766:Gm13089 UTSW 4 143699239 missense probably damaging 0.98
R7774:Gm13089 UTSW 4 143697106 missense possibly damaging 0.89
R7816:Gm13089 UTSW 4 143698194 missense probably benign 0.00
R8137:Gm13089 UTSW 4 143699265 missense probably damaging 1.00
Z1088:Gm13089 UTSW 4 143698080 missense probably benign
Z1176:Gm13089 UTSW 4 143696945 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTCTTGTATACAGTCTGCATG -3'
(R):5'- CTCAGGGTTTGATTCTAGGCAC -3'

Sequencing Primer
(F):5'- CAGTCTGCATGTACAATTTTGAAG -3'
(R):5'- GTTTGATTCTAGGCACAGGAATAAGC -3'
Posted On2019-05-15