Incidental Mutation 'R7140:Xab2'
ID553401
Institutional Source Beutler Lab
Gene Symbol Xab2
Ensembl Gene ENSMUSG00000019470
Gene NameXPA binding protein 2
Synonyms0610041O14Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3608421-3621316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3618117 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 154 (R154C)
Ref Sequence ENSEMBL: ENSMUSP00000019614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019614] [ENSMUST00000156380] [ENSMUST00000159235] [ENSMUST00000207389] [ENSMUST00000207428] [ENSMUST00000208950]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019614
AA Change: R154C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470
AA Change: R154C

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122654
Predicted Effect probably benign
Transcript: ENSMUST00000156380
SMART Domains Protein: ENSMUSP00000137626
Gene: ENSMUSG00000087687

DomainStartEndE-ValueType
Pfam:DUF2346 1 72 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470
AA Change: R151C

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207257
Predicted Effect probably benign
Transcript: ENSMUST00000207389
Predicted Effect probably benign
Transcript: ENSMUST00000207428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208185
Predicted Effect probably benign
Transcript: ENSMUST00000208950
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype PHENOTYPE: Homozygous null embryos die by the blastocyst stage (E3.5) and some eight-cell stage embryos do not undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Xab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Xab2 APN 8 3611723 missense probably damaging 1.00
IGL01308:Xab2 APN 8 3616332 missense probably benign 0.07
IGL01324:Xab2 APN 8 3621232 missense possibly damaging 0.80
IGL01340:Xab2 APN 8 3614381 missense probably damaging 1.00
IGL01613:Xab2 APN 8 3610880 missense probably benign 0.01
IGL02622:Xab2 APN 8 3611699 missense probably benign 0.01
IGL02809:Xab2 APN 8 3610175 missense probably benign 0.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0544:Xab2 UTSW 8 3610994 missense probably damaging 1.00
R0607:Xab2 UTSW 8 3613605 missense probably benign 0.05
R0735:Xab2 UTSW 8 3613649 missense possibly damaging 0.50
R0943:Xab2 UTSW 8 3613667 missense probably benign 0.00
R1507:Xab2 UTSW 8 3616031 missense possibly damaging 0.93
R1664:Xab2 UTSW 8 3619068 unclassified probably null
R1954:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R1955:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R3767:Xab2 UTSW 8 3619053 missense probably damaging 1.00
R4399:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4421:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4440:Xab2 UTSW 8 3616353 missense probably benign 0.01
R4553:Xab2 UTSW 8 3611015 missense probably benign 0.00
R4580:Xab2 UTSW 8 3610162 missense probably damaging 1.00
R4608:Xab2 UTSW 8 3618105 missense probably benign 0.23
R4707:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
R5522:Xab2 UTSW 8 3611718 missense probably benign 0.06
R6063:Xab2 UTSW 8 3613051 missense possibly damaging 0.93
R6273:Xab2 UTSW 8 3611822 missense probably damaging 1.00
R6487:Xab2 UTSW 8 3613879 missense possibly damaging 0.75
R7648:Xab2 UTSW 8 3610638 missense probably benign 0.00
R7767:Xab2 UTSW 8 3619018 missense probably benign 0.08
Z1176:Xab2 UTSW 8 3618969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCTATTCATCGGAGCCTC -3'
(R):5'- AGGTGATGACCCCTATTGCTTC -3'

Sequencing Primer
(F):5'- ATCGGAGCCTCTTCCTGCAG -3'
(R):5'- CCCTGTGCCCTAGATATGAAGTG -3'
Posted On2019-05-15