Incidental Mutation 'R7140:Zfp958'
ID553402
Institutional Source Beutler Lab
Gene Symbol Zfp958
Ensembl Gene ENSMUSG00000058748
Gene Namezinc finger protein 958
SynonymsBC003267
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4613167-4630231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4628481 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 169 (A169S)
Ref Sequence ENSEMBL: ENSMUSP00000143842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073201] [ENSMUST00000202692]
Predicted Effect probably benign
Transcript: ENSMUST00000073201
AA Change: A168S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072937
Gene: ENSMUSG00000058748
AA Change: A168S

DomainStartEndE-ValueType
KRAB 3 65 1.96e-17 SMART
ZnF_C2H2 102 124 2.67e-1 SMART
ZnF_C2H2 130 152 8.47e-4 SMART
ZnF_C2H2 158 180 5.5e-3 SMART
ZnF_C2H2 186 208 1.38e-3 SMART
ZnF_C2H2 214 236 9.96e-1 SMART
ZnF_C2H2 242 264 2.15e-5 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.69e-3 SMART
ZnF_C2H2 326 348 5.14e-3 SMART
ZnF_C2H2 354 376 2.91e-2 SMART
ZnF_C2H2 382 404 2.27e-4 SMART
ZnF_C2H2 410 432 4.79e-3 SMART
ZnF_C2H2 438 460 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202692
AA Change: A169S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143842
Gene: ENSMUSG00000058748
AA Change: A169S

DomainStartEndE-ValueType
KRAB 4 66 1.96e-17 SMART
ZnF_C2H2 103 125 2.67e-1 SMART
ZnF_C2H2 131 153 8.47e-4 SMART
ZnF_C2H2 159 181 5.5e-3 SMART
ZnF_C2H2 187 209 1.38e-3 SMART
ZnF_C2H2 215 237 9.96e-1 SMART
ZnF_C2H2 243 265 2.15e-5 SMART
ZnF_C2H2 271 293 3.16e-3 SMART
ZnF_C2H2 299 321 1.69e-3 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 2.91e-2 SMART
ZnF_C2H2 383 405 2.27e-4 SMART
ZnF_C2H2 411 433 4.79e-3 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Other mutations in Zfp958
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Zfp958 APN 8 4628917 missense probably damaging 1.00
IGL02185:Zfp958 APN 8 4628990 nonsense probably null
IGL02716:Zfp958 APN 8 4625967 critical splice donor site probably null
R1118:Zfp958 UTSW 8 4626169 missense possibly damaging 0.50
R1119:Zfp958 UTSW 8 4626169 missense possibly damaging 0.50
R1478:Zfp958 UTSW 8 4629190 missense probably damaging 1.00
R1816:Zfp958 UTSW 8 4629147 missense possibly damaging 0.89
R1837:Zfp958 UTSW 8 4628590 missense probably damaging 1.00
R1838:Zfp958 UTSW 8 4628590 missense probably damaging 1.00
R3763:Zfp958 UTSW 8 4626226 critical splice donor site probably null
R5257:Zfp958 UTSW 8 4628456 missense probably benign 0.28
R5258:Zfp958 UTSW 8 4628456 missense probably benign 0.28
R5304:Zfp958 UTSW 8 4626196 missense possibly damaging 0.73
R5512:Zfp958 UTSW 8 4625838 critical splice acceptor site probably null
R5907:Zfp958 UTSW 8 4629072 missense probably benign 0.01
R6604:Zfp958 UTSW 8 4628245 missense probably damaging 1.00
R6688:Zfp958 UTSW 8 4628940 missense possibly damaging 0.91
R6727:Zfp958 UTSW 8 4628247 missense probably benign 0.08
R6981:Zfp958 UTSW 8 4626170 missense probably benign 0.00
R7010:Zfp958 UTSW 8 4628377 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGAATGTAATCCATGTGGTAAAGC -3'
(R):5'- TGGTTGCATTCAAAGGGTTTCTC -3'

Sequencing Primer
(F):5'- GGTAAAGCCTTTGCATATCACTGC -3'
(R):5'- GGTCTGAAAAGGCTTTACCACACTG -3'
Posted On2019-05-15