Incidental Mutation 'R7140:Olfr1362'
ID553420
Institutional Source Beutler Lab
Gene Symbol Olfr1362
Ensembl Gene ENSMUSG00000051258
Gene Nameolfactory receptor 1362
SynonymsGA_x6K02T2QHY8-11628399-11628868, GA_x6K02T2QHY8-11617756-11618682, MOR256-8, Olfr1363-ps1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21610978-21614022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21611127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 281 (V281M)
Ref Sequence ENSEMBL: ENSMUSP00000061660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051874
AA Change: V281M

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061660
Gene: ENSMUSG00000051258
AA Change: V281M

DomainStartEndE-ValueType
Pfam:7tm_4 32 307 3.5e-51 PFAM
Pfam:7tm_1 41 290 9e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Olfr1362
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Olfr1362 APN 13 21611351 missense probably damaging 0.99
R0070:Olfr1362 UTSW 13 21611261 missense possibly damaging 0.60
R0070:Olfr1362 UTSW 13 21611261 missense possibly damaging 0.60
R1458:Olfr1362 UTSW 13 21611822 missense probably benign 0.37
R1587:Olfr1362 UTSW 13 21611913 missense probably benign 0.01
R1588:Olfr1362 UTSW 13 21611913 missense probably benign 0.01
R1607:Olfr1362 UTSW 13 21611764 missense probably benign 0.04
R1708:Olfr1362 UTSW 13 21611070 missense probably damaging 0.98
R4633:Olfr1362 UTSW 13 21611228 missense probably damaging 0.99
R6223:Olfr1362 UTSW 13 21611366 missense probably benign
R6229:Olfr1362 UTSW 13 21611649 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAAAGAGTACTTCAGTGTGTC -3'
(R):5'- GGTGGAAATGTTGTCCTTCAC -3'

Sequencing Primer
(F):5'- CTTCAGTGTGTCTAATACATTAGCTG -3'
(R):5'- CTATGGTTACATTGCTGCAGC -3'
Posted On2019-05-15