Incidental Mutation 'R7140:Tfap2a'
ID553421
Institutional Source Beutler Lab
Gene Symbol Tfap2a
Ensembl Gene ENSMUSG00000021359
Gene Nametranscription factor AP-2, alpha
SynonymsTcfap2a, Ap2, Ap-2 (a), AP-2 alpha, Ap2tf, AP2alpha
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location40715302-40738376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40730047 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 7 (S7P)
Ref Sequence ENSEMBL: ENSMUSP00000021787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021787] [ENSMUST00000110193] [ENSMUST00000223869] [ENSMUST00000224665] [ENSMUST00000224999] [ENSMUST00000225180]
Predicted Effect probably benign
Transcript: ENSMUST00000021787
AA Change: S7P

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021787
Gene: ENSMUSG00000021359
AA Change: S7P

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 82 95 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
Pfam:TF_AP-2 201 408 1.6e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110193
SMART Domains Protein: ENSMUSP00000105822
Gene: ENSMUSG00000021359

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
low complexity region 88 101 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
Pfam:TF_AP-2 209 409 7.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223869
Predicted Effect probably benign
Transcript: ENSMUST00000224665
Predicted Effect probably benign
Transcript: ENSMUST00000224999
Predicted Effect probably benign
Transcript: ENSMUST00000225180
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: This gene is a member of the activator protein 2 (AP-2) transcription factor family. The protein encoded by this gene can act as both an activator and repressor of gene transcription, and plays an important role in early embryogenesis, specifically in cranial development. This protein forms both homodimers and heterodimers, and binds to a GC-rich consensus sequence found in some promoters and enhancers. Disruption of this gene causes perinatal death, with neural tube, craniofacial, and limb mesenchyme defects. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die perinatally with anencephaly, craniofacial and neural tube defects, thoraco-abdominoschisis and defects in sensory organs, cranial ganglia, skeleton, and heart. On some genetic backgrounds, heterozygotes may exhibit exencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Tfap2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4366001:Tfap2a UTSW 13 40721374 missense possibly damaging 0.67
R0124:Tfap2a UTSW 13 40717411 splice site probably benign
R0400:Tfap2a UTSW 13 40717412 splice site probably benign
R0486:Tfap2a UTSW 13 40728694 missense probably damaging 1.00
R1132:Tfap2a UTSW 13 40721391 splice site probably null
R1418:Tfap2a UTSW 13 40717204 missense possibly damaging 0.89
R1751:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1767:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1802:Tfap2a UTSW 13 40725170 missense probably damaging 1.00
R1865:Tfap2a UTSW 13 40728408 missense probably damaging 1.00
R4913:Tfap2a UTSW 13 40717230 missense probably damaging 1.00
R5764:Tfap2a UTSW 13 40728355 missense possibly damaging 0.64
R6378:Tfap2a UTSW 13 40723241 missense possibly damaging 0.48
R6496:Tfap2a UTSW 13 40728775 missense probably damaging 1.00
R6751:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6773:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6774:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6786:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R7027:Tfap2a UTSW 13 40733674 missense probably benign 0.02
R7268:Tfap2a UTSW 13 40728760 missense possibly damaging 0.91
R7299:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
R7301:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
R7689:Tfap2a UTSW 13 40728575 missense probably damaging 1.00
R7761:Tfap2a UTSW 13 40725180 missense probably benign 0.12
R8005:Tfap2a UTSW 13 40719208 missense possibly damaging 0.61
R8170:Tfap2a UTSW 13 40719268 missense probably benign 0.00
R8423:Tfap2a UTSW 13 40719230 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CTCTGGAGCAAGTAAAGACGC -3'
(R):5'- ACTCGGTGGTACAAGTTCGG -3'

Sequencing Primer
(F):5'- CGAACCCGGCGAGAAACTG -3'
(R):5'- GGTACAAGTTCGGATGGATCC -3'
Posted On2019-05-15