Incidental Mutation 'R7140:Trpc7'
ID553423
Institutional Source Beutler Lab
Gene Symbol Trpc7
Ensembl Gene ENSMUSG00000021541
Gene Nametransient receptor potential cation channel, subfamily C, member 7
SynonymsTrrp8, TRP7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location56773113-56895993 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 56789674 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 656 (Y656*)
Ref Sequence ENSEMBL: ENSMUSP00000022023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022023] [ENSMUST00000109871] [ENSMUST00000151918] [ENSMUST00000173817] [ENSMUST00000174457]
Predicted Effect probably null
Transcript: ENSMUST00000022023
AA Change: Y656*
SMART Domains Protein: ENSMUSP00000022023
Gene: ENSMUSG00000021541
AA Change: Y656*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 6e-28 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Pfam:Ion_trans 387 684 2.4e-34 PFAM
Pfam:PKD_channel 427 679 5.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109871
AA Change: Y656*
SMART Domains Protein: ENSMUSP00000105497
Gene: ENSMUSG00000021541
AA Change: Y656*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 1.1e-31 PFAM
transmembrane domain 352 374 N/A INTRINSIC
transmembrane domain 389 406 N/A INTRINSIC
Pfam:PKD_channel 427 679 1.6e-13 PFAM
Pfam:Ion_trans 441 672 7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151918
SMART Domains Protein: ENSMUSP00000119809
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 4.6e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173067
SMART Domains Protein: ENSMUSP00000134481
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 5.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173466
SMART Domains Protein: ENSMUSP00000134285
Gene: ENSMUSG00000021541

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 9.5e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173513
AA Change: Y539*
SMART Domains Protein: ENSMUSP00000134662
Gene: ENSMUSG00000021541
AA Change: Y539*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.5e-31 PFAM
Pfam:PKD_channel 311 563 2.6e-13 PFAM
Pfam:Ion_trans 325 556 1.1e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173817
AA Change: Y595*
SMART Domains Protein: ENSMUSP00000133411
Gene: ENSMUSG00000021541
AA Change: Y595*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 345 N/A INTRINSIC
Pfam:PKD_channel 366 618 3.7e-13 PFAM
Pfam:Ion_trans 380 611 1.2e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174457
AA Change: Y601*
SMART Domains Protein: ENSMUSP00000133305
Gene: ENSMUSG00000021541
AA Change: Y601*

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
Pfam:PKD_channel 372 624 3.8e-13 PFAM
Pfam:Ion_trans 386 617 1.3e-35 PFAM
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the transient receptor potential channel family of proteins, which form six-transmembrane cation-permeable channels that are calcium permeant. Knock out mice are viable but display a reduction in the gamma wave activity that precedes seizure induction in response to a muscrarinic agonist, suggesting a functional role for this protein in initiation of seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Trpc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Trpc7 APN 13 56773809 missense possibly damaging 0.64
IGL00809:Trpc7 APN 13 56822488 missense probably benign 0.00
IGL01011:Trpc7 APN 13 56804540 missense probably damaging 1.00
IGL01517:Trpc7 APN 13 56861065 missense probably damaging 1.00
IGL01824:Trpc7 APN 13 56789722 nonsense probably null
IGL02055:Trpc7 APN 13 56887544 missense probably benign 0.13
IGL02267:Trpc7 APN 13 56860930 missense probably damaging 1.00
IGL02323:Trpc7 APN 13 56783751 missense possibly damaging 0.91
IGL02451:Trpc7 APN 13 56822461 missense probably damaging 0.98
IGL02635:Trpc7 APN 13 56776168 missense probably damaging 1.00
IGL03335:Trpc7 APN 13 56887691 missense probably damaging 1.00
PIT4305001:Trpc7 UTSW 13 56887508 missense probably benign 0.00
R0217:Trpc7 UTSW 13 56789768 nonsense probably null
R0611:Trpc7 UTSW 13 56887823 missense probably damaging 1.00
R0919:Trpc7 UTSW 13 56822649 splice site probably benign
R1235:Trpc7 UTSW 13 56887539 missense probably damaging 1.00
R1751:Trpc7 UTSW 13 56776143 missense probably damaging 1.00
R4324:Trpc7 UTSW 13 56887356 missense probably damaging 0.99
R4649:Trpc7 UTSW 13 56887554 missense probably damaging 1.00
R4731:Trpc7 UTSW 13 56804553 missense probably damaging 1.00
R5379:Trpc7 UTSW 13 56804550 missense probably damaging 1.00
R5834:Trpc7 UTSW 13 56776158 missense probably damaging 1.00
R5985:Trpc7 UTSW 13 56810545 missense probably damaging 0.96
R6244:Trpc7 UTSW 13 56773892 missense probably damaging 1.00
R6599:Trpc7 UTSW 13 56810380 splice site probably null
R6778:Trpc7 UTSW 13 56804687 missense probably damaging 1.00
R7150:Trpc7 UTSW 13 56783696 missense probably benign 0.00
R7156:Trpc7 UTSW 13 56789766 missense possibly damaging 0.61
R7238:Trpc7 UTSW 13 56826897 missense probably benign 0.17
R7716:Trpc7 UTSW 13 56789760 missense probably damaging 1.00
R7739:Trpc7 UTSW 13 56773766 makesense probably null
Z1177:Trpc7 UTSW 13 56810444 missense probably benign 0.00
Z1177:Trpc7 UTSW 13 56822432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCCAGGGAGAATGTCTGTTAC -3'
(R):5'- ATGAGAGGGCAGCTTTCATG -3'

Sequencing Primer
(F):5'- TCTTAGCATCACACGTGAGG -3'
(R):5'- AGGGCAGCTTTCATGTTAAAAGTG -3'
Posted On2019-05-15