Incidental Mutation 'R7140:Arhgef3'
ID553427
Institutional Source Beutler Lab
Gene Symbol Arhgef3
Ensembl Gene ENSMUSG00000021895
Gene NameRho guanine nucleotide exchange factor (GEF) 3
Synonyms9830169H03Rik, 1200004I24Rik, C76747
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27114899-27403911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27401707 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 442 (N442Y)
Ref Sequence ENSEMBL: ENSMUSP00000046486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049206] [ENSMUST00000224981] [ENSMUST00000225949]
Predicted Effect probably damaging
Transcript: ENSMUST00000049206
AA Change: N442Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046486
Gene: ENSMUSG00000021895
AA Change: N442Y

DomainStartEndE-ValueType
RhoGEF 132 309 4.11e-51 SMART
PH 318 457 3.26e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224981
AA Change: N435Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225949
AA Change: N462Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean platelet volume and a mild delay in platelet recovery in response to thrombocytopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Arhgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Arhgef3 APN 14 27401919 nonsense probably null
IGL02178:Arhgef3 APN 14 27265529 nonsense probably null
IGL02302:Arhgef3 APN 14 27362842 missense probably benign 0.08
IGL02505:Arhgef3 APN 14 27394000 missense possibly damaging 0.92
IGL03203:Arhgef3 APN 14 27394116 missense probably damaging 1.00
IGL03339:Arhgef3 APN 14 27401857 missense probably damaging 0.99
R0762:Arhgef3 UTSW 14 27397627 missense probably damaging 1.00
R1192:Arhgef3 UTSW 14 27379706 missense probably damaging 1.00
R1572:Arhgef3 UTSW 14 27401735 missense probably damaging 1.00
R1794:Arhgef3 UTSW 14 27397605 missense probably benign 0.44
R2426:Arhgef3 UTSW 14 27384181 nonsense probably null
R2509:Arhgef3 UTSW 14 27379676 missense probably damaging 1.00
R4932:Arhgef3 UTSW 14 27384213 missense probably damaging 0.99
R5017:Arhgef3 UTSW 14 27265530 missense possibly damaging 0.85
R5216:Arhgef3 UTSW 14 27401842 missense probably benign 0.00
R6562:Arhgef3 UTSW 14 27152996 start gained probably benign
R6951:Arhgef3 UTSW 14 27144018 start gained probably benign
R7361:Arhgef3 UTSW 14 27265578 missense possibly damaging 0.56
R8042:Arhgef3 UTSW 14 27362809 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGAGTCCTGCATCAGTTAGAGAC -3'
(R):5'- TCCATACTGCAGTCCGACTC -3'

Sequencing Primer
(F):5'- AATCAGTGTCTGGGATACGCC -3'
(R):5'- GACTCGCTGTCCGATTGGTC -3'
Posted On2019-05-15