Incidental Mutation 'R7140:Notch3'
ID553436
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7140 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32156377 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 357 (V357A)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087723
AA Change: V357A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: V357A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Tmem45b A T 9: 31,434,484 probably null Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
marginal UTSW 17 32164224 missense probably benign
R1954_Notch3_144 UTSW 17 32166678 missense probably benign
R4879_Notch3_171 UTSW 17 32147963 missense probably benign 0.00
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 splice site probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
R7860:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R8052:Notch3 UTSW 17 32146571 missense probably damaging 1.00
R8250:Notch3 UTSW 17 32132336 missense probably damaging 1.00
R8296:Notch3 UTSW 17 32122739 missense probably damaging 1.00
R8306:Notch3 UTSW 17 32158112 missense probably damaging 0.99
R8458:Notch3 UTSW 17 32156050 missense probably damaging 1.00
R8539:Notch3 UTSW 17 32156355 missense possibly damaging 0.92
R8865:Notch3 UTSW 17 32122116 missense probably benign 0.01
R8925:Notch3 UTSW 17 32153818 missense probably benign 0.14
R8927:Notch3 UTSW 17 32153818 missense probably benign 0.14
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Z1176:Notch3 UTSW 17 32141516 missense probably benign 0.12
Z1176:Notch3 UTSW 17 32151370 missense probably damaging 1.00
Z1177:Notch3 UTSW 17 32166694 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTTCACAGGGGTTGGC -3'
(R):5'- CGTAGCTGAGTGATGGTATTCATTC -3'

Sequencing Primer
(F):5'- TTGGCACCTGCAAGAAGG -3'
(R):5'- ATTCGTTGTATGCTCATGGTCC -3'
Posted On2019-05-15