Mutagenetix > Incidental Mutation

Incidental Mutation 'R7142:P3h1'

553457

Institutional Source

Beutler Lab

Gene Symbol

P3h1

Ensembl Gene

ENSMUSG00000028641

Gene Name

prolyl 3-hydroxylase 1

Synonyms

Lepre1, Gros1, 2410024C15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7142 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119232915-119248975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119247161 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 626 (D626E)

Ref Sequence

ENSEMBL: ENSMUSP00000112504 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278]

AlphaFold

Q3V1T4

Predicted Effect

probably benign
Transcript: ENSMUST00000030393
AA Change: D633E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: D633E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	2.49e-12	PROSPERO
internal_repeat_1	294	369	2.49e-12	PROSPERO
Blast:P4Hc	419	462	2e-14	BLAST
P4Hc	479	687	5.96e-53	SMART
low complexity region	714	725	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081606
AA Change: D447E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: D447E

Domain	Start	End	E-Value	Type
SCOP:d1hxia_	80	195	4e-5	SMART
Blast:P4Hc	125	206	2e-11	BLAST
Blast:P4Hc	233	276	1e-14	BLAST
P4Hc	293	501	5.96e-53	SMART
low complexity region	528	539	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102662
AA Change: D626E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: D626E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	1.9e-12	PROSPERO
internal_repeat_1	294	369	1.9e-12	PROSPERO
Blast:P4Hc	412	455	2e-14	BLAST
P4Hc	472	680	5.96e-53	SMART
low complexity region	707	718	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121111
AA Change: D626E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: D626E

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	2.32e-12	PROSPERO
internal_repeat_1	294	369	2.32e-12	PROSPERO
Blast:P4Hc	412	455	2e-14	BLAST
P4Hc	472	680	5.96e-53	SMART
low complexity region	707	718	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136278

SMART Domains

Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	198	6.76e-13	PROSPERO
internal_repeat_1	294	356	6.76e-13	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	A	10: 79,067,612	H290L	probably damaging	Het
Abca1	T	A	4: 53,082,050	S737C	probably damaging	Het
Abca14	G	C	7: 120,251,183	V753L	possibly damaging	Het
Adgrl1	C	T	8: 83,937,200	H1099Y	probably benign	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Aldh1l1	G	A	6: 90,563,416	D228N	probably damaging	Het
Cacna1e	G	T	1: 154,412,484	Q1883K	probably damaging	Het
Caskin2	A	G	11: 115,806,736	Y125H	probably benign	Het
Ccdc85a	A	T	11: 28,577,192	Y139N	probably damaging	Het
Cd93	C	T	2: 148,441,805	W540*	probably null	Het
Cdh3	G	A	8: 106,545,228		probably null	Het
Chmp2b	G	A	16: 65,546,908	Q88*	probably null	Het
Cpt1a	T	C	19: 3,375,100	M489T	probably benign	Het
Ctsk	G	A	3: 95,506,948	V274M	possibly damaging	Het
Cyp3a44	A	G	5: 145,777,961	V460A	probably benign	Het
Cypt4	C	T	9: 24,625,444	R77*	probably null	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dnah7a	A	T	1: 53,413,768	Y3850*	probably null	Het
Drosha	A	T	15: 12,924,146	T1205S	possibly damaging	Het
Eif3j2	T	C	18: 43,477,400	E116G	probably damaging	Het
Ercc5	A	G	1: 44,174,214	E790G	probably damaging	Het
Fam163b	C	T	2: 27,113,555	R29Q	probably damaging	Het
Fbxo44	C	T	4: 148,158,812	G50E	unknown	Het
Foxo3	T	C	10: 42,274,595		probably null	Het
Gm9992	G	A	17: 7,376,622	T96I	probably damaging	Het
Gnal	C	T	18: 67,218,528	P386L	probably damaging	Het
Gpc5	T	A	14: 115,417,203	H478Q	probably benign	Het
Grhl2	A	T	15: 37,279,582	D178V	probably benign	Het
Gtf2i	C	A	5: 134,244,851	V755L	possibly damaging	Het
Hal	T	C	10: 93,500,651	V414A	possibly damaging	Het
Hmx2	T	C	7: 131,555,736	V193A	probably damaging	Het
Il17a	T	A	1: 20,732,103	M12K	probably benign	Het
Invs	T	A	4: 48,407,696	I557N	probably damaging	Het
Kng1	T	A	16: 23,079,420	H523Q	probably benign	Het
Lrp4	T	A	2: 91,494,994	I1388N	probably damaging	Het
Mboat4	A	G	8: 34,120,137	I63V	probably benign	Het
Mcoln2	G	A	3: 146,183,569		probably null	Het
Mgat5	A	T	1: 127,412,187	D435V	probably damaging	Het
Mri1	C	A	8: 84,257,124	R46L	probably damaging	Het
Mxra8	A	T	4: 155,843,062	Y409F	probably benign	Het
Nlrp1b	T	A	11: 71,172,075	R720*	probably null	Het
Ofcc1	T	C	13: 40,004,062	I887V	probably benign	Het
Olfr1156	T	C	2: 87,949,712	I174V	probably benign	Het
Otud4	T	A	8: 79,672,762		probably null	Het
Pde2a	A	T	7: 101,504,650	D485V	probably damaging	Het
Phldb2	G	A	16: 45,757,176	R1129*	probably null	Het
Pkn1	T	C	8: 83,693,967	E10G	possibly damaging	Het
Psd2	A	G	18: 35,980,044	D264G	possibly damaging	Het
Psg29	A	G	7: 17,210,621	D352G	probably damaging	Het
Rgs14	T	C	13: 55,379,604	S218P	probably damaging	Het
Sec14l2	T	C	11: 4,098,379	T380A	probably benign	Het
Sept12	T	C	16: 4,988,362	T312A	unknown	Het
Skint5	A	T	4: 113,571,594	V1075E	unknown	Het
Ston2	A	G	12: 91,647,235	S800P	probably damaging	Het
Tmem106b	A	G	6: 13,081,565	N157S	probably damaging	Het
Tmem132b	G	A	5: 125,622,673	G133S	probably damaging	Het
Tmie	A	T	9: 110,870,681	M55K	possibly damaging	Het
Trpc6	A	T	9: 8,653,016	R608*	probably null	Het
Usp35	A	G	7: 97,311,547	S891P	probably damaging	Het
Vmn1r178	A	G	7: 23,893,610	T28A	probably damaging	Het
Wnk1	T	A	6: 119,949,279	M1324L	probably benign	Het
Wrnip1	C	A	13: 32,802,633	S132R	possibly damaging	Het
Wsb1	T	C	11: 79,250,988	K68E	probably benign	Het
Zfp433	A	T	10: 81,720,206	K181*	probably null	Het

Other mutations in P3h1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:P3h1	APN	4	119235283	missense	probably damaging	1.00
IGL01623:P3h1	APN	4	119235283	missense	probably damaging	1.00
IGL01645:P3h1	APN	4	119236783	missense	probably damaging	1.00
IGL02140:P3h1	APN	4	119237865	missense	probably damaging	1.00
IGL02415:P3h1	APN	4	119247955	missense	probably benign
IGL02543:P3h1	APN	4	119237856	splice site	probably benign
IGL02870:P3h1	APN	4	119247571	missense	probably damaging	1.00
IGL02972:P3h1	APN	4	119247960	missense	possibly damaging	0.75
IGL03067:P3h1	APN	4	119235280	missense	probably damaging	0.99
IGL03077:P3h1	APN	4	119236786	missense	probably damaging	1.00
woohoo	UTSW	4	119241132	nonsense	probably null
R0194:P3h1	UTSW	4	119237952	missense	probably damaging	1.00
R0523:P3h1	UTSW	4	119241530	missense	probably benign	0.32
R0734:P3h1	UTSW	4	119238688	missense	probably damaging	1.00
R0944:P3h1	UTSW	4	119238759	missense	probably benign	0.00
R1018:P3h1	UTSW	4	119237907	missense	probably damaging	0.99
R1978:P3h1	UTSW	4	119247976	missense	probably null	0.00
R2697:P3h1	UTSW	4	119247180	missense	probably damaging	1.00
R5668:P3h1	UTSW	4	119244046	missense	possibly damaging	0.89
R5750:P3h1	UTSW	4	119238666	missense	probably damaging	0.96
R5965:P3h1	UTSW	4	119248227	missense	probably benign	0.00
R5987:P3h1	UTSW	4	119246665	missense	probably damaging	1.00
R6111:P3h1	UTSW	4	119241132	nonsense	probably null
R6786:P3h1	UTSW	4	119237954	missense	possibly damaging	0.65
R8068:P3h1	UTSW	4	119236862	missense	probably damaging	1.00
R8304:P3h1	UTSW	4	119247205	missense	probably damaging	1.00
R9502:P3h1	UTSW	4	119236811	missense	possibly damaging	0.86
R9680:P3h1	UTSW	4	119233231	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GGCTGGGTTTGACACAAAGG -3'
(R):5'- GGAGAGCTATCATATCCCAAAGCC -3'

Sequencing Primer
(F):5'- CTGGGTTTGACACAAAGGTATGC -3'
(R):5'- GCTATCATATCCCAAAGCCCCTGG -3'

Posted On

2019-05-15