Incidental Mutation 'R7142:Usp35'
ID553469
Institutional Source Beutler Lab
Gene Symbol Usp35
Ensembl Gene ENSMUSG00000035713
Gene Nameubiquitin specific peptidase 35
SynonymsLOC381901, LOC244144
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7142 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97309380-97332020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97311547 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 891 (S891P)
Ref Sequence ENSEMBL: ENSMUSP00000137726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000139582] [ENSMUST00000168435]
Predicted Effect probably benign
Transcript: ENSMUST00000004622
SMART Domains Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508

DomainStartEndE-ValueType
PH 9 121 1.07e-22 SMART
Blast:PH 268 314 4e-11 BLAST
low complexity region 348 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139582
AA Change: S891P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137726
Gene: ENSMUSG00000035713
AA Change: S891P

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 5.2e-50 PFAM
Pfam:UCH_1 441 890 1.5e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168435
AA Change: S891P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137927
Gene: ENSMUSG00000035713
AA Change: S891P

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 7.1e-48 PFAM
Pfam:UCH_1 441 890 7.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,612 H290L probably damaging Het
Abca1 T A 4: 53,082,050 S737C probably damaging Het
Abca14 G C 7: 120,251,183 V753L possibly damaging Het
Adgrl1 C T 8: 83,937,200 H1099Y probably benign Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Aldh1l1 G A 6: 90,563,416 D228N probably damaging Het
Cacna1e G T 1: 154,412,484 Q1883K probably damaging Het
Caskin2 A G 11: 115,806,736 Y125H probably benign Het
Ccdc85a A T 11: 28,577,192 Y139N probably damaging Het
Cd93 C T 2: 148,441,805 W540* probably null Het
Cdh3 G A 8: 106,545,228 probably null Het
Chmp2b G A 16: 65,546,908 Q88* probably null Het
Cpt1a T C 19: 3,375,100 M489T probably benign Het
Ctsk G A 3: 95,506,948 V274M possibly damaging Het
Cyp3a44 A G 5: 145,777,961 V460A probably benign Het
Cypt4 C T 9: 24,625,444 R77* probably null Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah7a A T 1: 53,413,768 Y3850* probably null Het
Drosha A T 15: 12,924,146 T1205S possibly damaging Het
Eif3j2 T C 18: 43,477,400 E116G probably damaging Het
Ercc5 A G 1: 44,174,214 E790G probably damaging Het
Fam163b C T 2: 27,113,555 R29Q probably damaging Het
Fbxo44 C T 4: 148,158,812 G50E unknown Het
Foxo3 T C 10: 42,274,595 probably null Het
Gm9992 G A 17: 7,376,622 T96I probably damaging Het
Gnal C T 18: 67,218,528 P386L probably damaging Het
Gpc5 T A 14: 115,417,203 H478Q probably benign Het
Grhl2 A T 15: 37,279,582 D178V probably benign Het
Gtf2i C A 5: 134,244,851 V755L possibly damaging Het
Hal T C 10: 93,500,651 V414A possibly damaging Het
Hmx2 T C 7: 131,555,736 V193A probably damaging Het
Il17a T A 1: 20,732,103 M12K probably benign Het
Invs T A 4: 48,407,696 I557N probably damaging Het
Kng1 T A 16: 23,079,420 H523Q probably benign Het
Lrp4 T A 2: 91,494,994 I1388N probably damaging Het
Mboat4 A G 8: 34,120,137 I63V probably benign Het
Mcoln2 G A 3: 146,183,569 probably null Het
Mgat5 A T 1: 127,412,187 D435V probably damaging Het
Mri1 C A 8: 84,257,124 R46L probably damaging Het
Mxra8 A T 4: 155,843,062 Y409F probably benign Het
Nlrp1b T A 11: 71,172,075 R720* probably null Het
Ofcc1 T C 13: 40,004,062 I887V probably benign Het
Olfr1156 T C 2: 87,949,712 I174V probably benign Het
Otud4 T A 8: 79,672,762 probably null Het
P3h1 T A 4: 119,247,161 D626E probably benign Het
Pde2a A T 7: 101,504,650 D485V probably damaging Het
Phldb2 G A 16: 45,757,176 R1129* probably null Het
Pkn1 T C 8: 83,693,967 E10G possibly damaging Het
Psd2 A G 18: 35,980,044 D264G possibly damaging Het
Psg29 A G 7: 17,210,621 D352G probably damaging Het
Rgs14 T C 13: 55,379,604 S218P probably damaging Het
Sec14l2 T C 11: 4,098,379 T380A probably benign Het
Sept12 T C 16: 4,988,362 T312A unknown Het
Skint5 A T 4: 113,571,594 V1075E unknown Het
Ston2 A G 12: 91,647,235 S800P probably damaging Het
Tmem106b A G 6: 13,081,565 N157S probably damaging Het
Tmem132b G A 5: 125,622,673 G133S probably damaging Het
Tmie A T 9: 110,870,681 M55K possibly damaging Het
Trpc6 A T 9: 8,653,016 R608* probably null Het
Vmn1r178 A G 7: 23,893,610 T28A probably damaging Het
Wnk1 T A 6: 119,949,279 M1324L probably benign Het
Wrnip1 C A 13: 32,802,633 S132R possibly damaging Het
Wsb1 T C 11: 79,250,988 K68E probably benign Het
Zfp433 A T 10: 81,720,206 K181* probably null Het
Other mutations in Usp35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03239:Usp35 APN 7 97321592 missense possibly damaging 0.62
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0739:Usp35 UTSW 7 97311667 nonsense probably null
R2655:Usp35 UTSW 7 97312147 missense probably benign
R3623:Usp35 UTSW 7 97312620 missense probably damaging 1.00
R4750:Usp35 UTSW 7 97310339 missense possibly damaging 0.85
R4967:Usp35 UTSW 7 97313575 missense probably damaging 1.00
R5317:Usp35 UTSW 7 97311639 missense probably damaging 0.99
R5341:Usp35 UTSW 7 97325927 missense probably damaging 1.00
R5761:Usp35 UTSW 7 97312351 missense probably benign 0.00
R5894:Usp35 UTSW 7 97313077 missense probably damaging 1.00
R6113:Usp35 UTSW 7 97324326 missense probably damaging 1.00
R6282:Usp35 UTSW 7 97325948 missense probably damaging 1.00
R6454:Usp35 UTSW 7 97311560 missense probably damaging 0.98
R6454:Usp35 UTSW 7 97311644 nonsense probably null
R7158:Usp35 UTSW 7 97325964 start codon destroyed probably null 0.89
R7260:Usp35 UTSW 7 97320079 missense probably damaging 0.98
RF003:Usp35 UTSW 7 97322096 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGGAAATGGCCTCCATCAGG -3'
(R):5'- GATCCTGGACGATGTCACCATC -3'

Sequencing Primer
(F):5'- CTCCATCAGGTCCTTGTGGAG -3'
(R):5'- TTTGCTGCGCCTGCCAC -3'
Posted On2019-05-15