Incidental Mutation 'R7142:Nlrp1b'
ID553486
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7142 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 71172075 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 720 (R720*)
Ref Sequence ENSEMBL: ENSMUSP00000104155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108514] [ENSMUST00000108515] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect probably null
Transcript: ENSMUST00000094046
AA Change: R717*
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: R717*

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108514
AA Change: R720*
SMART Domains Protein: ENSMUSP00000104154
Gene: ENSMUSG00000070390
AA Change: R720*

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.1e-40 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 814 1068 2.4e-136 PFAM
Pfam:CARD 1086 1169 3.7e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108515
AA Change: R720*
SMART Domains Protein: ENSMUSP00000104155
Gene: ENSMUSG00000070390
AA Change: R720*

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.9e-41 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 815 1067 5e-104 PFAM
Pfam:CARD 1086 1169 1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108516
AA Change: R717*
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: R717*

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,067,612 H290L probably damaging Het
Abca1 T A 4: 53,082,050 S737C probably damaging Het
Abca14 G C 7: 120,251,183 V753L possibly damaging Het
Adgrl1 C T 8: 83,937,200 H1099Y probably benign Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Aldh1l1 G A 6: 90,563,416 D228N probably damaging Het
Cacna1e G T 1: 154,412,484 Q1883K probably damaging Het
Caskin2 A G 11: 115,806,736 Y125H probably benign Het
Ccdc85a A T 11: 28,577,192 Y139N probably damaging Het
Cd93 C T 2: 148,441,805 W540* probably null Het
Cdh3 G A 8: 106,545,228 probably null Het
Chmp2b G A 16: 65,546,908 Q88* probably null Het
Cpt1a T C 19: 3,375,100 M489T probably benign Het
Ctsk G A 3: 95,506,948 V274M possibly damaging Het
Cyp3a44 A G 5: 145,777,961 V460A probably benign Het
Cypt4 C T 9: 24,625,444 R77* probably null Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dnah7a A T 1: 53,413,768 Y3850* probably null Het
Drosha A T 15: 12,924,146 T1205S possibly damaging Het
Eif3j2 T C 18: 43,477,400 E116G probably damaging Het
Ercc5 A G 1: 44,174,214 E790G probably damaging Het
Fam163b C T 2: 27,113,555 R29Q probably damaging Het
Fbxo44 C T 4: 148,158,812 G50E unknown Het
Foxo3 T C 10: 42,274,595 probably null Het
Gm9992 G A 17: 7,376,622 T96I probably damaging Het
Gnal C T 18: 67,218,528 P386L probably damaging Het
Gpc5 T A 14: 115,417,203 H478Q probably benign Het
Grhl2 A T 15: 37,279,582 D178V probably benign Het
Gtf2i C A 5: 134,244,851 V755L possibly damaging Het
Hal T C 10: 93,500,651 V414A possibly damaging Het
Hmx2 T C 7: 131,555,736 V193A probably damaging Het
Il17a T A 1: 20,732,103 M12K probably benign Het
Invs T A 4: 48,407,696 I557N probably damaging Het
Kng1 T A 16: 23,079,420 H523Q probably benign Het
Lrp4 T A 2: 91,494,994 I1388N probably damaging Het
Mboat4 A G 8: 34,120,137 I63V probably benign Het
Mcoln2 G A 3: 146,183,569 probably null Het
Mgat5 A T 1: 127,412,187 D435V probably damaging Het
Mri1 C A 8: 84,257,124 R46L probably damaging Het
Mxra8 A T 4: 155,843,062 Y409F probably benign Het
Ofcc1 T C 13: 40,004,062 I887V probably benign Het
Olfr1156 T C 2: 87,949,712 I174V probably benign Het
Otud4 T A 8: 79,672,762 probably null Het
P3h1 T A 4: 119,247,161 D626E probably benign Het
Pde2a A T 7: 101,504,650 D485V probably damaging Het
Phldb2 G A 16: 45,757,176 R1129* probably null Het
Pkn1 T C 8: 83,693,967 E10G possibly damaging Het
Psd2 A G 18: 35,980,044 D264G possibly damaging Het
Psg29 A G 7: 17,210,621 D352G probably damaging Het
Rgs14 T C 13: 55,379,604 S218P probably damaging Het
Sec14l2 T C 11: 4,098,379 T380A probably benign Het
Sept12 T C 16: 4,988,362 T312A unknown Het
Skint5 A T 4: 113,571,594 V1075E unknown Het
Ston2 A G 12: 91,647,235 S800P probably damaging Het
Tmem106b A G 6: 13,081,565 N157S probably damaging Het
Tmem132b G A 5: 125,622,673 G133S probably damaging Het
Tmie A T 9: 110,870,681 M55K possibly damaging Het
Trpc6 A T 9: 8,653,016 R608* probably null Het
Usp35 A G 7: 97,311,547 S891P probably damaging Het
Vmn1r178 A G 7: 23,893,610 T28A probably damaging Het
Wnk1 T A 6: 119,949,279 M1324L probably benign Het
Wrnip1 C A 13: 32,802,633 S132R possibly damaging Het
Wsb1 T C 11: 79,250,988 K68E probably benign Het
Zfp433 A T 10: 81,720,206 K181* probably null Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
androcles UTSW 11 71172075 nonsense probably null
Fangled UTSW 11 71172171 missense possibly damaging 0.94
glitz UTSW 11 71181550 missense possibly damaging 0.89
honeydew UTSW 11 71217884 missense possibly damaging 0.93
Mush UTSW 11 71156079 missense probably damaging 1.00
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
R7349:Nlrp1b UTSW 11 71182117 missense probably benign 0.36
R7354:Nlrp1b UTSW 11 71181550 missense possibly damaging 0.89
R7750:Nlrp1b UTSW 11 71168839 missense probably benign 0.11
R7913:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
R7994:Nlrp1b UTSW 11 71217711 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTGATTTCACCATGCCCAAC -3'
(R):5'- CATGCAGGCTTGTTGAATGCG -3'

Sequencing Primer
(F):5'- CCATGAGGACACTGAGTTTTCCAG -3'
(R):5'- TGTTGAATGCGGCCTCACAC -3'
Posted On2019-05-15