Mutagenetix > Incidental Mutation

Incidental Mutation 'R7143:Prss56'

553507

Institutional Source

Beutler Lab

Gene Symbol

Prss56

Ensembl Gene

ENSMUSG00000036480

Gene Name

protease, serine 56

Synonyms

Prss56, 1700027L20Rik

MMRRC Submission

Accession Numbers

Genbank: XM_487606

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7143 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87183313-87188405 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87188153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 583 (I583K)

Ref Sequence

ENSEMBL: ENSMUSP00000138773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044533] [ENSMUST00000073252] [ENSMUST00000186373]

AlphaFold

F2YMG0

Predicted Effect

probably benign
Transcript: ENSMUST00000044533
AA Change: I583K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138773
Gene: ENSMUSG00000036480
AA Change: I583K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Tryp_SPc	58	103	1e-5	BLAST
Tryp_SPc	108	336	1.17e-84	SMART
Blast:Tryp_SPc	340	385	4e-9	BLAST
low complexity region	386	407	N/A	INTRINSIC
low complexity region	410	422	N/A	INTRINSIC
Blast:Tryp_SPc	432	499	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000073252

SMART Domains

Protein: ENSMUSP00000072983
Gene: ENSMUSG00000026251

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
Pfam:Neur_chan_LBD	28	249	4.4e-70	PFAM
Pfam:Neur_chan_memb	256	492	1.1e-74	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000186373

SMART Domains

Protein: ENSMUSP00000139537
Gene: ENSMUSG00000026251

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	1	140	4.2e-40	PFAM
Pfam:Neur_chan_memb	147	383	6.6e-63	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a peptidase S1 domain and possesses trypsin-like serine protease activity. The encoded protein may play a role in eye development, and mutations in this gene are a cause of autosomal recessive posterior microphthalmos. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for an ENU induced mutation show increased intraocular pressure, variable decreases in eye axial length, and narrow iridocorneal angles. Homozygous mice model angle-closure glaucoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	C	T	7: 104,059,215	C129Y	probably damaging	Het
Agbl4	A	G	4: 111,617,136	N374S	probably damaging	Het
Agl	A	G	3: 116,792,021	S153P	probably damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Ankrd17	C	A	5: 90,285,961	A650S	possibly damaging	Het
Ankrd53	A	G	6: 83,762,911	R16G	possibly damaging	Het
Apba2	T	C	7: 64,744,417	L570P	probably damaging	Het
Asap1	A	G	15: 64,191,528	F101L	probably damaging	Het
Cadm4	T	A	7: 24,499,567	I89N	possibly damaging	Het
Cadps	C	T	14: 12,491,838	V771I	probably benign	Het
Cenph	A	G	13: 100,761,777	V206A	possibly damaging	Het
Cenpn	A	G	8: 116,937,227	T253A	probably benign	Het
Cep120	C	T	18: 53,683,385	G939R	probably benign	Het
Cfap57	G	A	4: 118,620,709		probably benign	Het
Clip1	T	C	5: 123,653,610	I166V	probably benign	Het
Cstf3	T	A	2: 104,646,616	V144E	probably benign	Het
Cyp21a1	T	A	17: 34,802,326	H357L	probably damaging	Het
Cyth3	T	A	5: 143,684,396	V12E	unknown	Het
Dgat2	T	C	7: 99,157,124	I289V	probably benign	Het
Dip2a	A	G	10: 76,297,791	C527R	probably damaging	Het
Dnah17	A	C	11: 118,086,130	W1879G	probably damaging	Het
Dnaic2	A	G	11: 114,754,250	T504A	possibly damaging	Het
Efl1	C	T	7: 82,762,680	P759L	probably damaging	Het
Egfr	A	C	11: 16,871,627	I351L	probably benign	Het
Ercc6	G	A	14: 32,570,305	E1209K	probably damaging	Het
Fam135b	A	T	15: 71,479,151	M292K	probably benign	Het
Fbxl7	C	A	15: 26,543,158	V468L	probably benign	Het
Fhl2	G	T	1: 43,141,851	H60N	probably damaging	Het
G6pc	G	T	11: 101,370,723	R83L	probably damaging	Het
Gata4	C	A	14: 63,204,617	R252L	probably damaging	Het
Glt8d1	T	A	14: 31,006,645	I10N	probably damaging	Het
Gm10471	T	A	5: 26,085,676	I166F	probably benign	Het
Gm10803	T	A	2: 93,563,959	Y25*	probably null	Het
Gm19345	T	C	7: 19,857,834	F108S	unknown	Het
Gm4952	A	G	19: 12,618,407	T54A	possibly damaging	Het
Gprc6a	C	T	10: 51,614,890	R921H	probably benign	Het
Hc	A	T	2: 35,050,438	H129Q	probably benign	Het
Heatr5a	T	C	12: 51,961,468	R31G	probably benign	Het
Hephl1	T	C	9: 15,060,810	K945E	possibly damaging	Het
Ik	G	T	18: 36,751,177	M237I	probably damaging	Het
Izumo1	T	A	7: 45,627,095	S361T	probably benign	Het
Kcnq4	A	G	4: 120,711,239	F427L	probably benign	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Kifap3	T	A	1: 163,856,040	M430K	possibly damaging	Het
Lamb3	A	G	1: 193,304,565	E53G	probably damaging	Het
Lrp1b	A	T	2: 41,312,643	I1266K		Het
Nat8	A	T	6: 85,830,503	I216K	probably benign	Het
Ncapd2	T	C	6: 125,179,561	I454V	probably benign	Het
Nlrp4f	A	T	13: 65,195,306	V153E	probably damaging	Het
Nlrp4f	G	C	13: 65,199,352	Q9E	possibly damaging	Het
Npy2r	A	T	3: 82,540,943	I175N	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1247	T	C	2: 89,610,019	M28V	probably benign	Het
Olfr364-ps1	A	G	2: 37,146,874	T221A	probably benign	Het
Olfr665	C	T	7: 104,881,186	P160S	probably damaging	Het
Pcdh9	T	C	14: 93,888,272	N154S	probably damaging	Het
Pcdhb2	A	T	18: 37,295,881	E302D	probably benign	Het
Pclo	T	A	5: 14,858,822	V5048E	unknown	Het
Pcnt	A	G	10: 76,389,060	L1870S	possibly damaging	Het
Pigc	T	C	1: 161,970,592	Y48H	probably damaging	Het
Pisd	C	T	5: 32,738,502	V241I	possibly damaging	Het
Pkhd1l1	A	T	15: 44,573,637	M3464L	possibly damaging	Het
Pofut2	T	A	10: 77,259,426	I35N	probably benign	Het
Prss27	A	G	17: 24,045,658	Y265C	probably damaging	Het
Rnpep	T	C	1: 135,283,749	E87G	probably benign	Het
Shtn1	T	C	19: 59,018,906	H304R	probably damaging	Het
Slc23a4	A	T	6: 34,978,913	I62N	probably damaging	Het
Slc35e2	A	T	4: 155,618,594	I355F	probably benign	Het
Snx25	T	C	8: 46,035,715	I868V	possibly damaging	Het
Spatc1l	T	A	10: 76,569,931	L323Q	probably damaging	Het
Taok1	A	G	11: 77,537,988	V962A	probably benign	Het
Tas2r140	A	G	6: 133,055,519	I92T	probably benign	Het
Trim17	C	A	11: 58,965,184	Y22*	probably null	Het
Tti1	T	A	2: 158,007,676	M548L	probably benign	Het
Unc93b1	T	C	19: 3,935,204	V4A	unknown	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r225	A	T	17: 20,502,384	Y29F	probably benign	Het
Vmn1r34	A	T	6: 66,637,664	I30N	probably benign	Het
Vmn2r67	T	A	7: 85,152,638	M152L	probably benign	Het
Wdr20rt	T	G	12: 65,225,918	F52V	probably benign	Het
Zfp869	G	T	8: 69,706,656	H422Q	probably damaging	Het

Other mutations in Prss56

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
B5639:Prss56	UTSW	1	87187170	missense	probably benign
R0390:Prss56	UTSW	1	87184730	splice site	probably null
R4544:Prss56	UTSW	1	87184642	missense	probably damaging	0.99
R4723:Prss56	UTSW	1	87185337	missense	possibly damaging	0.54
R4749:Prss56	UTSW	1	87185583	missense	possibly damaging	0.88
R4898:Prss56	UTSW	1	87187986	missense	probably damaging	0.99
R5095:Prss56	UTSW	1	87188111	missense	probably damaging	1.00
R5176:Prss56	UTSW	1	87184158	missense	probably damaging	1.00
R5205:Prss56	UTSW	1	87185534	missense	probably damaging	1.00
R6029:Prss56	UTSW	1	87187557	nonsense	probably null
R6223:Prss56	UTSW	1	87185412	missense	probably benign	0.02
R7018:Prss56	UTSW	1	87185948	missense	possibly damaging	0.54
R7237:Prss56	UTSW	1	87184915	missense	probably damaging	0.99
R7284:Prss56	UTSW	1	87185401	missense	probably null	0.06
R7553:Prss56	UTSW	1	87183539	missense	probably benign	0.17
R7898:Prss56	UTSW	1	87184199	missense	probably benign	0.17
R8951:Prss56	UTSW	1	87188027	missense	probably damaging	0.97
R9733:Prss56	UTSW	1	87183497	missense	possibly damaging	0.93
R9771:Prss56	UTSW	1	87185643	missense	possibly damaging	0.88
RF024:Prss56	UTSW	1	87187170	missense	probably benign
Z1177:Prss56	UTSW	1	87186317	missense	probably damaging	0.99
Z1177:Prss56	UTSW	1	87187146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTGGGCTCCAAGACACTG -3'
(R):5'- TCTGGTGACACATTGAAGAAGATG -3'

Sequencing Primer
(F):5'- ACTGACAGGACTCTTCAGAGCTTG -3'
(R):5'- ATGAGTGAGATCCAGGATCCCC -3'

Posted On

2019-05-15