Incidental Mutation 'R7143:Kifap3'
ID553510
Institutional Source Beutler Lab
Gene Symbol Kifap3
Ensembl Gene ENSMUSG00000026585
Gene Namekinesin-associated protein 3
SynonymsSmg GDS, KAP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location163779583-163917109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 163825859 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 338 (N338I)
Ref Sequence ENSEMBL: ENSMUSP00000076830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]
Predicted Effect probably damaging
Transcript: ENSMUST00000027877
AA Change: N338I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: N338I

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077642
AA Change: N338I

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: N338I

DomainStartEndE-ValueType
KAP 13 720 N/A SMART
ARM 333 373 1.21e-3 SMART
ARM 374 412 9.68e0 SMART
ARM 578 620 1.28e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Kifap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Kifap3 APN 1 163797270 missense probably damaging 1.00
IGL01655:Kifap3 APN 1 163796049 splice site probably benign
IGL02385:Kifap3 APN 1 163865444 nonsense probably null
IGL02517:Kifap3 APN 1 163825871 splice site probably benign
IGL02756:Kifap3 APN 1 163862028 missense probably damaging 0.98
IGL03034:Kifap3 APN 1 163888277 missense probably benign 0.05
IGL03230:Kifap3 APN 1 163825724 missense probably benign 0.02
IGL03270:Kifap3 APN 1 163848733 missense probably benign 0.18
IGL03340:Kifap3 APN 1 163829149 missense possibly damaging 0.94
R0207:Kifap3 UTSW 1 163883386 missense probably benign 0.00
R0333:Kifap3 UTSW 1 163797264 missense probably damaging 1.00
R0426:Kifap3 UTSW 1 163865552 splice site probably benign
R1467:Kifap3 UTSW 1 163829120 splice site probably benign
R1482:Kifap3 UTSW 1 163825859 missense possibly damaging 0.91
R1547:Kifap3 UTSW 1 163794086 missense probably benign 0.01
R1704:Kifap3 UTSW 1 163829196 missense possibly damaging 0.50
R1724:Kifap3 UTSW 1 163783097 nonsense probably null
R1982:Kifap3 UTSW 1 163862022 nonsense probably null
R2233:Kifap3 UTSW 1 163856065 missense probably benign
R2273:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2274:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R2275:Kifap3 UTSW 1 163868758 missense possibly damaging 0.94
R3420:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3421:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R3422:Kifap3 UTSW 1 163794026 missense probably damaging 1.00
R4194:Kifap3 UTSW 1 163915825 missense probably benign 0.10
R4260:Kifap3 UTSW 1 163862028 missense probably damaging 0.98
R4464:Kifap3 UTSW 1 163817895 missense probably benign 0.00
R4635:Kifap3 UTSW 1 163814435 missense probably damaging 1.00
R5090:Kifap3 UTSW 1 163856076 missense possibly damaging 0.89
R5426:Kifap3 UTSW 1 163779871 start codon destroyed probably null 0.30
R5868:Kifap3 UTSW 1 163865472 missense probably damaging 1.00
R6107:Kifap3 UTSW 1 163868769 missense possibly damaging 0.50
R6437:Kifap3 UTSW 1 163857526 missense probably damaging 0.99
R6744:Kifap3 UTSW 1 163848670 missense probably benign 0.00
R7051:Kifap3 UTSW 1 163794080 missense probably damaging 1.00
R7143:Kifap3 UTSW 1 163856040 missense possibly damaging 0.66
R7216:Kifap3 UTSW 1 163795989 missense probably damaging 0.98
R7467:Kifap3 UTSW 1 163815833 missense probably benign
R7564:Kifap3 UTSW 1 163915768 missense probably damaging 1.00
U24488:Kifap3 UTSW 1 163783035 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTGACTCAGCCATTGACTCC -3'
(R):5'- CTGATCTATTAACCAGTTCAGGATG -3'

Sequencing Primer
(F):5'- GACTCAGCCATTGACTCCATCTG -3'
(R):5'- GTTTAAGTAACACCAAATGAACCTG -3'
Posted On2019-05-15