Mutagenetix > Incidental Mutations

Incidental Mutation 'R7143:Kifap3'

553511

Institutional Source

Beutler Lab

Gene Symbol

Kifap3

Ensembl Gene

ENSMUSG00000026585

Gene Name

kinesin-associated protein 3

Synonyms

Smg GDS, KAP3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7143 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

163779583-163917109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 163856040 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 430 (M430K)

Ref Sequence

ENSEMBL: ENSMUSP00000027877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027877
AA Change: M430K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: M430K

Domain	Start	End	E-Value	Type
KAP	13	720	N/A	SMART
ARM	333	373	1.21e-3	SMART
ARM	374	412	9.68e0	SMART
ARM	578	620	1.28e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077642
AA Change: M430K

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: M430K

Domain	Start	End	E-Value	Type
KAP	13	720	N/A	SMART
ARM	333	373	1.21e-3	SMART
ARM	374	412	9.68e0	SMART
ARM	578	620	1.28e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	C	T	7: 104,059,215	C129Y	probably damaging	Het
Agbl4	A	G	4: 111,617,136	N374S	probably damaging	Het
Agl	A	G	3: 116,792,021	S153P	probably damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Ankrd17	C	A	5: 90,285,961	A650S	possibly damaging	Het
Ankrd53	A	G	6: 83,762,911	R16G	possibly damaging	Het
Apba2	T	C	7: 64,744,417	L570P	probably damaging	Het
Asap1	A	G	15: 64,191,528	F101L	probably damaging	Het
Cadm4	T	A	7: 24,499,567	I89N	possibly damaging	Het
Cadps	C	T	14: 12,491,838	V771I	probably benign	Het
Cenph	A	G	13: 100,761,777	V206A	possibly damaging	Het
Cenpn	A	G	8: 116,937,227	T253A	probably benign	Het
Cep120	C	T	18: 53,683,385	G939R	probably benign	Het
Cfap57	G	A	4: 118,620,709		probably benign	Het
Clip1	T	C	5: 123,653,610	I166V	probably benign	Het
Cstf3	T	A	2: 104,646,616	V144E	probably benign	Het
Cyp21a1	T	A	17: 34,802,326	H357L	probably damaging	Het
Cyth3	T	A	5: 143,684,396	V12E	unknown	Het
Dgat2	T	C	7: 99,157,124	I289V	probably benign	Het
Dip2a	A	G	10: 76,297,791	C527R	probably damaging	Het
Dnah17	A	C	11: 118,086,130	W1879G	probably damaging	Het
Dnaic2	A	G	11: 114,754,250	T504A	possibly damaging	Het
Efl1	C	T	7: 82,762,680	P759L	probably damaging	Het
Egfr	A	C	11: 16,871,627	I351L	probably benign	Het
Ercc6	G	A	14: 32,570,305	E1209K	probably damaging	Het
Fam135b	A	T	15: 71,479,151	M292K	probably benign	Het
Fbxl7	C	A	15: 26,543,158	V468L	probably benign	Het
Fhl2	G	T	1: 43,141,851	H60N	probably damaging	Het
G6pc	G	T	11: 101,370,723	R83L	probably damaging	Het
Gata4	C	A	14: 63,204,617	R252L	probably damaging	Het
Glt8d1	T	A	14: 31,006,645	I10N	probably damaging	Het
Gm10471	T	A	5: 26,085,676	I166F	probably benign	Het
Gm10803	T	A	2: 93,563,959	Y25*	probably null	Het
Gm19345	T	C	7: 19,857,834	F108S	unknown	Het
Gm4952	A	G	19: 12,618,407	T54A	possibly damaging	Het
Gprc6a	C	T	10: 51,614,890	R921H	probably benign	Het
Hc	A	T	2: 35,050,438	H129Q	probably benign	Het
Heatr5a	T	C	12: 51,961,468	R31G	probably benign	Het
Hephl1	T	C	9: 15,060,810	K945E	possibly damaging	Het
Ik	G	T	18: 36,751,177	M237I	probably damaging	Het
Izumo1	T	A	7: 45,627,095	S361T	probably benign	Het
Kcnq4	A	G	4: 120,711,239	F427L	probably benign	Het
Lamb3	A	G	1: 193,304,565	E53G	probably damaging	Het
Lrp1b	A	T	2: 41,312,643	I1266K		Het
Nat8	A	T	6: 85,830,503	I216K	probably benign	Het
Ncapd2	T	C	6: 125,179,561	I454V	probably benign	Het
Nlrp4f	A	T	13: 65,195,306	V153E	probably damaging	Het
Nlrp4f	G	C	13: 65,199,352	Q9E	possibly damaging	Het
Npy2r	A	T	3: 82,540,943	I175N	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1247	T	C	2: 89,610,019	M28V	probably benign	Het
Olfr364-ps1	A	G	2: 37,146,874	T221A	probably benign	Het
Olfr665	C	T	7: 104,881,186	P160S	probably damaging	Het
Pcdh9	T	C	14: 93,888,272	N154S	probably damaging	Het
Pcdhb2	A	T	18: 37,295,881	E302D	probably benign	Het
Pclo	T	A	5: 14,858,822	V5048E	unknown	Het
Pcnt	A	G	10: 76,389,060	L1870S	possibly damaging	Het
Pigc	T	C	1: 161,970,592	Y48H	probably damaging	Het
Pisd	C	T	5: 32,738,502	V241I	possibly damaging	Het
Pkhd1l1	A	T	15: 44,573,637	M3464L	possibly damaging	Het
Pofut2	T	A	10: 77,259,426	I35N	probably benign	Het
Prss27	A	G	17: 24,045,658	Y265C	probably damaging	Het
Prss56	T	A	1: 87,188,153	I583K	probably benign	Het
Rnpep	T	C	1: 135,283,749	E87G	probably benign	Het
Shtn1	T	C	19: 59,018,906	H304R	probably damaging	Het
Slc23a4	A	T	6: 34,978,913	I62N	probably damaging	Het
Slc35e2	A	T	4: 155,618,594	I355F	probably benign	Het
Snx25	T	C	8: 46,035,715	I868V	possibly damaging	Het
Spatc1l	T	A	10: 76,569,931	L323Q	probably damaging	Het
Taok1	A	G	11: 77,537,988	V962A	probably benign	Het
Tas2r140	A	G	6: 133,055,519	I92T	probably benign	Het
Trim17	C	A	11: 58,965,184	Y22*	probably null	Het
Tti1	T	A	2: 158,007,676	M548L	probably benign	Het
Unc93b1	T	C	19: 3,935,204	V4A	unknown	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r225	A	T	17: 20,502,384	Y29F	probably benign	Het
Vmn1r34	A	T	6: 66,637,664	I30N	probably benign	Het
Vmn2r67	T	A	7: 85,152,638	M152L	probably benign	Het
Wdr20rt	T	G	12: 65,225,918	F52V	probably benign	Het
Zfp869	G	T	8: 69,706,656	H422Q	probably damaging	Het

Other mutations in Kifap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Kifap3	APN	1	163797270	missense	probably damaging	1.00
IGL01655:Kifap3	APN	1	163796049	splice site	probably benign
IGL02385:Kifap3	APN	1	163865444	nonsense	probably null
IGL02517:Kifap3	APN	1	163825871	splice site	probably benign
IGL02756:Kifap3	APN	1	163862028	missense	probably damaging	0.98
IGL03034:Kifap3	APN	1	163888277	missense	probably benign	0.05
IGL03230:Kifap3	APN	1	163825724	missense	probably benign	0.02
IGL03270:Kifap3	APN	1	163848733	missense	probably benign	0.18
IGL03340:Kifap3	APN	1	163829149	missense	possibly damaging	0.94
R0207:Kifap3	UTSW	1	163883386	missense	probably benign	0.00
R0333:Kifap3	UTSW	1	163797264	missense	probably damaging	1.00
R0426:Kifap3	UTSW	1	163865552	splice site	probably benign
R1467:Kifap3	UTSW	1	163829120	splice site	probably benign
R1482:Kifap3	UTSW	1	163825859	missense	possibly damaging	0.91
R1547:Kifap3	UTSW	1	163794086	missense	probably benign	0.01
R1704:Kifap3	UTSW	1	163829196	missense	possibly damaging	0.50
R1724:Kifap3	UTSW	1	163783097	nonsense	probably null
R1982:Kifap3	UTSW	1	163862022	nonsense	probably null
R2233:Kifap3	UTSW	1	163856065	missense	probably benign
R2273:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R2274:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R2275:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R3420:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R3421:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R3422:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R4194:Kifap3	UTSW	1	163915825	missense	probably benign	0.10
R4260:Kifap3	UTSW	1	163862028	missense	probably damaging	0.98
R4464:Kifap3	UTSW	1	163817895	missense	probably benign	0.00
R4635:Kifap3	UTSW	1	163814435	missense	probably damaging	1.00
R5090:Kifap3	UTSW	1	163856076	missense	possibly damaging	0.89
R5426:Kifap3	UTSW	1	163779871	start codon destroyed	probably null	0.30
R5868:Kifap3	UTSW	1	163865472	missense	probably damaging	1.00
R6107:Kifap3	UTSW	1	163868769	missense	possibly damaging	0.50
R6437:Kifap3	UTSW	1	163857526	missense	probably damaging	0.99
R6744:Kifap3	UTSW	1	163848670	missense	probably benign	0.00
R7051:Kifap3	UTSW	1	163794080	missense	probably damaging	1.00
R7143:Kifap3	UTSW	1	163825859	missense	possibly damaging	0.91
R7216:Kifap3	UTSW	1	163795989	missense	probably damaging	0.98
R7467:Kifap3	UTSW	1	163815833	missense	probably benign
R7564:Kifap3	UTSW	1	163915768	missense	probably damaging	1.00
R7939:Kifap3	UTSW	1	163815858	nonsense	probably null
R8108:Kifap3	UTSW	1	163797362	missense	probably damaging	0.99
R8496:Kifap3	UTSW	1	163829297	critical splice donor site	probably null
U24488:Kifap3	UTSW	1	163783035	missense	possibly damaging	0.64
Z1177:Kifap3	UTSW	1	163862062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGACTGCTCAGCTTCCAG -3'
(R):5'- TGTATCTACCAGAAAAGGATACCC -3'

Sequencing Primer
(F):5'- GCTCAGCTTCCAGGCAATAATTC -3'
(R):5'- TCTACCAGAAAAGGATACCCTATTAG -3'

Posted On

2019-05-15