Mutagenetix > Incidental Mutation

Incidental Mutation 'R7143:Lrp1b'

553515

Institutional Source

Beutler Lab

Gene Symbol

Lrp1b

Ensembl Gene

ENSMUSG00000049252

Gene Name

low density lipoprotein-related protein 1B (deleted in tumors)

Synonyms

9630004P12Rik

MMRRC Submission

Accession Numbers

Genbank: NM_053011.2

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7143 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40595246-42653624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41312643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1266 (I1266K)

Ref Sequence

ENSEMBL: ENSMUSP00000054275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052550] [ENSMUST00000167270] [ENSMUST00000203080]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000054275
Gene: ENSMUSG00000049252
AA Change: I1266K

Domain	Start	End	E-Value	Type
low complexity region	3	19	N/A	INTRINSIC
low complexity region	35	46	N/A	INTRINSIC
LDLa	62	102	2.97e-12	SMART
LDLa	107	146	1.31e-8	SMART
EGF	150	185	1.95e1	SMART
EGF_CA	186	225	8.37e-8	SMART
LY	256	300	4.06e1	SMART
LY	304	348	1.15e-5	SMART
LY	349	392	1.17e-11	SMART
LY	393	435	1.12e-8	SMART
LY	436	478	2.21e1	SMART
EGF	505	548	2.45e0	SMART
LY	579	621	1.32e-5	SMART
LY	622	665	1.88e-10	SMART
LY	668	717	1.47e-12	SMART
LY	718	760	5.78e-11	SMART
LY	761	802	1.45e0	SMART
EGF_like	828	865	4.55e1	SMART
LDLa	875	914	7.15e-15	SMART
LDLa	916	955	5.26e-13	SMART
LDLa	957	995	6.13e-14	SMART
LDLa	997	1035	6.47e-13	SMART
LDLa	1036	1075	1.76e-14	SMART
LDLa	1083	1121	2.29e-13	SMART
LDLa	1125	1164	3.36e-11	SMART
LDLa	1166	1206	2.57e-7	SMART
EGF	1206	1244	1.58e-3	SMART
EGF	1248	1284	4.56e0	SMART
LY	1311	1353	4.85e-4	SMART
LY	1358	1400	6.49e-14	SMART
LY	1401	1445	8.18e-11	SMART
LY	1446	1490	4.25e-9	SMART
LY	1492	1534	5.4e-2	SMART
EGF	1561	1601	9.41e-2	SMART
LY	1629	1671	3.03e-5	SMART
LY	1672	1716	1.22e-9	SMART
LY	1718	1756	1.02e-2	SMART
LY	1757	1798	8.25e-7	SMART
EGF	1868	1906	4.03e-1	SMART
LY	1933	1975	1.01e-1	SMART
LY	1976	2018	3.03e-14	SMART
LY	2019	2062	2.16e-10	SMART
LY	2063	2105	4.09e-11	SMART
LY	2107	2149	9.96e0	SMART
EGF	2177	2214	2.13e0	SMART
LY	2292	2334	6.96e-5	SMART
LY	2340	2385	1.07e-5	SMART
LY	2386	2428	1.1e-11	SMART
LY	2429	2470	4.78e-3	SMART
EGF	2498	2535	2.03e1	SMART
LDLa	2540	2580	1.1e-6	SMART
LDLa	2582	2619	1.72e-8	SMART
LDLa	2621	2658	2.45e-13	SMART
LDLa	2669	2707	6.53e-9	SMART
LDLa	2712	2749	7.97e-13	SMART
LDLa	2750	2789	1.22e-8	SMART
LDLa	2791	2832	3.07e-14	SMART
LDLa	2835	2873	7.32e-12	SMART
LDLa	2875	2917	1.85e-8	SMART
LDLa	2921	2958	4.76e-11	SMART
EGF_CA	2957	2998	1.79e-7	SMART
EGF_CA	2999	3039	1.85e-9	SMART
LY	3066	3111	2.58e-8	SMART
LY	3112	3152	1.22e-9	SMART
LY	3153	3196	8.84e-7	SMART
LY	3197	3237	3.22e-9	SMART
LY	3238	3279	1.04e-3	SMART
EGF	3307	3345	7.13e-2	SMART
LDLa	3347	3385	9.29e-14	SMART
LDLa	3387	3424	2.25e-12	SMART
LDLa	3426	3464	5.63e-13	SMART
LDLa	3466	3504	1.07e-13	SMART
LDLa	3506	3543	1.35e-15	SMART
EGF_like	3545	3581	2.8e1	SMART
LDLa	3545	3582	1.49e-12	SMART
LDLa	3583	3620	4.21e-12	SMART
LDLa	3624	3661	4.9e-13	SMART
LDLa	3662	3700	9.58e-16	SMART
LDLa	3704	3743	5.38e-10	SMART
LDLa	3745	3784	1.42e-9	SMART
LDLa	3792	3829	3.66e-12	SMART
EGF	3835	3874	3.71e0	SMART
EGF_CA	3875	3912	6.8e-8	SMART
LY	3987	4033	4.24e0	SMART
LY	4050	4093	4.46e-3	SMART
LY	4094	4136	1.73e-9	SMART
EGF	4206	4239	2.45e0	SMART
EGF	4247	4280	2.48e-1	SMART
EGF	4283	4316	1.49e-4	SMART
EGF	4319	4352	1.69e-3	SMART
EGF	4355	4388	1.18e1	SMART
EGF_like	4391	4423	6.67e1	SMART
EGF	4424	4458	1.61e0	SMART
transmembrane domain	4476	4498	N/A	INTRINSIC
low complexity region	4499	4509	N/A	INTRINSIC
low complexity region	4512	4523	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167270
AA Change: I1152K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129192
Gene: ENSMUSG00000049252
AA Change: I1152K

Domain	Start	End	E-Value	Type
EGF	5	40	1.95e1	SMART
EGF_CA	41	80	8.37e-8	SMART
LY	111	155	4.06e1	SMART
LY	159	203	1.15e-5	SMART
LY	204	247	1.17e-11	SMART
LY	248	290	1.12e-8	SMART
LY	291	333	2.21e1	SMART
EGF	360	403	2.45e0	SMART
LY	434	476	1.32e-5	SMART
LY	477	520	1.88e-10	SMART
LY	523	572	1.47e-12	SMART
LY	573	615	5.78e-11	SMART
LY	616	657	1.45e0	SMART
EGF_like	683	720	4.55e1	SMART
LDLa	730	769	7.15e-15	SMART
LDLa	771	810	5.26e-13	SMART
LDLa	812	850	6.13e-14	SMART
LDLa	852	890	6.47e-13	SMART
LDLa	891	930	1.76e-14	SMART
LDLa	938	976	2.29e-13	SMART
LDLa	980	1019	3.36e-11	SMART
LDLa	1021	1061	2.57e-7	SMART
EGF	1061	1099	1.58e-3	SMART
EGF	1103	1139	4.56e0	SMART
LY	1166	1208	4.85e-4	SMART
LY	1213	1255	6.49e-14	SMART
LY	1256	1300	8.18e-11	SMART
LY	1301	1345	4.25e-9	SMART
LY	1347	1389	5.4e-2	SMART
EGF	1416	1456	9.41e-2	SMART
LY	1484	1526	3.03e-5	SMART
LY	1527	1571	1.22e-9	SMART
LY	1573	1611	1.02e-2	SMART
LY	1612	1653	8.25e-7	SMART
EGF	1723	1761	4.03e-1	SMART
LY	1788	1830	1.01e-1	SMART
LY	1831	1873	3.03e-14	SMART
LY	1874	1917	2.16e-10	SMART
LY	1918	1960	4.09e-11	SMART
LY	1962	2004	9.96e0	SMART
EGF	2032	2069	2.13e0	SMART
LY	2147	2189	6.96e-5	SMART
LY	2195	2240	1.07e-5	SMART
LY	2241	2283	1.1e-11	SMART
LY	2284	2325	4.78e-3	SMART
EGF	2353	2390	2.03e1	SMART
LDLa	2395	2435	1.1e-6	SMART
LDLa	2437	2474	1.72e-8	SMART
LDLa	2476	2513	2.45e-13	SMART
LDLa	2524	2562	6.53e-9	SMART
LDLa	2567	2604	7.97e-13	SMART
LDLa	2605	2644	1.22e-8	SMART
LDLa	2646	2687	3.07e-14	SMART
LDLa	2690	2728	7.32e-12	SMART
LDLa	2730	2772	1.85e-8	SMART
LDLa	2776	2813	4.76e-11	SMART
EGF_CA	2812	2853	1.79e-7	SMART
EGF_CA	2854	2894	1.85e-9	SMART
LY	2921	2966	2.58e-8	SMART
LY	2967	3007	1.22e-9	SMART
LY	3008	3051	8.84e-7	SMART
LY	3052	3092	3.22e-9	SMART
LY	3093	3134	1.04e-3	SMART
EGF	3162	3200	7.13e-2	SMART
LDLa	3202	3240	9.29e-14	SMART
LDLa	3242	3279	2.25e-12	SMART
LDLa	3281	3319	5.63e-13	SMART
LDLa	3321	3357	5.86e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203080
AA Change: I411K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000145278
Gene: ENSMUSG00000049252
AA Change: I411K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LDLa	31	70	1.4e-13	SMART
LDLa	71	109	3e-16	SMART
LDLa	111	149	3.3e-15	SMART
LDLa	150	189	8.4e-17	SMART
LDLa	197	235	1.1e-15	SMART
LDLa	239	278	1.6e-13	SMART
LDLa	280	320	1.2e-9	SMART
EGF	320	358	7.8e-6	SMART
EGF	362	398	2.3e-2	SMART
LY	425	467	2.4e-6	SMART
LY	472	514	3.3e-16	SMART
LY	515	559	4.1e-13	SMART
LY	560	604	2.1e-11	SMART
LY	606	648	2.7e-4	SMART
EGF	675	715	4.6e-4	SMART
LY	743	782	8.1e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice appear normal, are fertile, have normal brain histology and function, normal plasma cholesterol and fasting triglycerides, and do not develop tumors. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, knock-out(3) Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	C	T	7: 104,059,215	C129Y	probably damaging	Het
Agbl4	A	G	4: 111,617,136	N374S	probably damaging	Het
Agl	A	G	3: 116,792,021	S153P	probably damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Ankrd17	C	A	5: 90,285,961	A650S	possibly damaging	Het
Ankrd53	A	G	6: 83,762,911	R16G	possibly damaging	Het
Apba2	T	C	7: 64,744,417	L570P	probably damaging	Het
Asap1	A	G	15: 64,191,528	F101L	probably damaging	Het
Cadm4	T	A	7: 24,499,567	I89N	possibly damaging	Het
Cadps	C	T	14: 12,491,838	V771I	probably benign	Het
Cenph	A	G	13: 100,761,777	V206A	possibly damaging	Het
Cenpn	A	G	8: 116,937,227	T253A	probably benign	Het
Cep120	C	T	18: 53,683,385	G939R	probably benign	Het
Cfap57	G	A	4: 118,620,709		probably benign	Het
Clip1	T	C	5: 123,653,610	I166V	probably benign	Het
Cstf3	T	A	2: 104,646,616	V144E	probably benign	Het
Cyp21a1	T	A	17: 34,802,326	H357L	probably damaging	Het
Cyth3	T	A	5: 143,684,396	V12E	unknown	Het
Dgat2	T	C	7: 99,157,124	I289V	probably benign	Het
Dip2a	A	G	10: 76,297,791	C527R	probably damaging	Het
Dnah17	A	C	11: 118,086,130	W1879G	probably damaging	Het
Dnaic2	A	G	11: 114,754,250	T504A	possibly damaging	Het
Efl1	C	T	7: 82,762,680	P759L	probably damaging	Het
Egfr	A	C	11: 16,871,627	I351L	probably benign	Het
Ercc6	G	A	14: 32,570,305	E1209K	probably damaging	Het
Fam135b	A	T	15: 71,479,151	M292K	probably benign	Het
Fbxl7	C	A	15: 26,543,158	V468L	probably benign	Het
Fhl2	G	T	1: 43,141,851	H60N	probably damaging	Het
G6pc	G	T	11: 101,370,723	R83L	probably damaging	Het
Gata4	C	A	14: 63,204,617	R252L	probably damaging	Het
Glt8d1	T	A	14: 31,006,645	I10N	probably damaging	Het
Gm10471	T	A	5: 26,085,676	I166F	probably benign	Het
Gm10803	T	A	2: 93,563,959	Y25*	probably null	Het
Gm19345	T	C	7: 19,857,834	F108S	unknown	Het
Gm4952	A	G	19: 12,618,407	T54A	possibly damaging	Het
Gprc6a	C	T	10: 51,614,890	R921H	probably benign	Het
Hc	A	T	2: 35,050,438	H129Q	probably benign	Het
Heatr5a	T	C	12: 51,961,468	R31G	probably benign	Het
Hephl1	T	C	9: 15,060,810	K945E	possibly damaging	Het
Ik	G	T	18: 36,751,177	M237I	probably damaging	Het
Izumo1	T	A	7: 45,627,095	S361T	probably benign	Het
Kcnq4	A	G	4: 120,711,239	F427L	probably benign	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Kifap3	T	A	1: 163,856,040	M430K	possibly damaging	Het
Lamb3	A	G	1: 193,304,565	E53G	probably damaging	Het
Nat8	A	T	6: 85,830,503	I216K	probably benign	Het
Ncapd2	T	C	6: 125,179,561	I454V	probably benign	Het
Nlrp4f	A	T	13: 65,195,306	V153E	probably damaging	Het
Nlrp4f	G	C	13: 65,199,352	Q9E	possibly damaging	Het
Npy2r	A	T	3: 82,540,943	I175N	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1247	T	C	2: 89,610,019	M28V	probably benign	Het
Olfr364-ps1	A	G	2: 37,146,874	T221A	probably benign	Het
Olfr665	C	T	7: 104,881,186	P160S	probably damaging	Het
Pcdh9	T	C	14: 93,888,272	N154S	probably damaging	Het
Pcdhb2	A	T	18: 37,295,881	E302D	probably benign	Het
Pclo	T	A	5: 14,858,822	V5048E	unknown	Het
Pcnt	A	G	10: 76,389,060	L1870S	possibly damaging	Het
Pigc	T	C	1: 161,970,592	Y48H	probably damaging	Het
Pisd	C	T	5: 32,738,502	V241I	possibly damaging	Het
Pkhd1l1	A	T	15: 44,573,637	M3464L	possibly damaging	Het
Pofut2	T	A	10: 77,259,426	I35N	probably benign	Het
Prss27	A	G	17: 24,045,658	Y265C	probably damaging	Het
Prss56	T	A	1: 87,188,153	I583K	probably benign	Het
Rnpep	T	C	1: 135,283,749	E87G	probably benign	Het
Shtn1	T	C	19: 59,018,906	H304R	probably damaging	Het
Slc23a4	A	T	6: 34,978,913	I62N	probably damaging	Het
Slc35e2	A	T	4: 155,618,594	I355F	probably benign	Het
Snx25	T	C	8: 46,035,715	I868V	possibly damaging	Het
Spatc1l	T	A	10: 76,569,931	L323Q	probably damaging	Het
Taok1	A	G	11: 77,537,988	V962A	probably benign	Het
Tas2r140	A	G	6: 133,055,519	I92T	probably benign	Het
Trim17	C	A	11: 58,965,184	Y22*	probably null	Het
Tti1	T	A	2: 158,007,676	M548L	probably benign	Het
Unc93b1	T	C	19: 3,935,204	V4A	unknown	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r225	A	T	17: 20,502,384	Y29F	probably benign	Het
Vmn1r34	A	T	6: 66,637,664	I30N	probably benign	Het
Vmn2r67	T	A	7: 85,152,638	M152L	probably benign	Het
Wdr20rt	T	G	12: 65,225,918	F52V	probably benign	Het
Zfp869	G	T	8: 69,706,656	H422Q	probably damaging	Het

Other mutations in Lrp1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Lrp1b	APN	2	41110861	missense	probably damaging	1.00
IGL00543:Lrp1b	APN	2	41468948	missense	possibly damaging	0.69
IGL00578:Lrp1b	APN	2	40679173	missense	unknown
IGL01020:Lrp1b	APN	2	40998247	missense	probably damaging	1.00
IGL01092:Lrp1b	APN	2	40750947	missense	probably damaging	0.97
IGL01155:Lrp1b	APN	2	41770935	missense	probably benign	0.17
IGL01361:Lrp1b	APN	2	41110751	splice site	probably benign
IGL01377:Lrp1b	APN	2	40601538	missense	probably damaging	1.00
IGL01459:Lrp1b	APN	2	40860714	missense	probably damaging	0.97
IGL01473:Lrp1b	APN	2	40611486	missense	probably damaging	0.97
IGL01528:Lrp1b	APN	2	40919182	missense	probably damaging	0.99
IGL01536:Lrp1b	APN	2	41110883	missense	probably benign	0.01
IGL01564:Lrp1b	APN	2	40677486	splice site	probably benign
IGL01747:Lrp1b	APN	2	40860685	missense	probably damaging	1.00
IGL01764:Lrp1b	APN	2	40697442	missense	unknown
IGL01783:Lrp1b	APN	2	41312572	missense	probably damaging	1.00
IGL01802:Lrp1b	APN	2	41511482	missense	probably benign	0.07
IGL01826:Lrp1b	APN	2	41449234	missense	probably damaging	1.00
IGL01884:Lrp1b	APN	2	41284213	nonsense	probably null
IGL01908:Lrp1b	APN	2	40702804	missense	probably benign
IGL01935:Lrp1b	APN	2	41268355	missense	probably damaging	1.00
IGL01959:Lrp1b	APN	2	41312527	missense	probably damaging	0.99
IGL02010:Lrp1b	APN	2	41468942	missense	probably damaging	1.00
IGL02022:Lrp1b	APN	2	41282160	missense	probably damaging	1.00
IGL02028:Lrp1b	APN	2	41511452	missense	probably damaging	1.00
IGL02034:Lrp1b	APN	2	41268370	nonsense	probably null
IGL02043:Lrp1b	APN	2	40697525	missense	probably null	0.44
IGL02066:Lrp1b	APN	2	41111079	nonsense	probably null
IGL02085:Lrp1b	APN	2	40889309	missense	probably benign
IGL02137:Lrp1b	APN	2	40730688	splice site	probably benign
IGL02218:Lrp1b	APN	2	41295672	missense	probably benign	0.11
IGL02409:Lrp1b	APN	2	41445196	missense	possibly damaging	0.93
IGL02513:Lrp1b	APN	2	41110753	critical splice donor site	probably null
IGL02543:Lrp1b	APN	2	40870401	missense	possibly damaging	0.89
IGL02701:Lrp1b	APN	2	41246017	missense	possibly damaging	0.50
IGL02728:Lrp1b	APN	2	40801398	missense	probably benign	0.03
IGL02739:Lrp1b	APN	2	41498215	missense	probably damaging	1.00
IGL02748:Lrp1b	APN	2	40702749	missense	probably damaging	0.99
IGL02754:Lrp1b	APN	2	40702794	missense	probably benign	0.02
IGL02797:Lrp1b	APN	2	41671057	missense
IGL02813:Lrp1b	APN	2	40679217	critical splice acceptor site	probably null
IGL02831:Lrp1b	APN	2	41193591	missense	probably damaging	1.00
IGL02869:Lrp1b	APN	2	40701830	missense	unknown
IGL02946:Lrp1b	APN	2	41312559	missense	probably damaging	1.00
IGL02952:Lrp1b	APN	2	41506703	missense	probably benign	0.33
IGL02958:Lrp1b	APN	2	41302916	missense	probably damaging	1.00
IGL02977:Lrp1b	APN	2	40730735	missense	probably damaging	1.00
IGL03001:Lrp1b	APN	2	40927889	missense	probably damaging	1.00
IGL03010:Lrp1b	APN	2	42323606	missense	possibly damaging	0.94
IGL03060:Lrp1b	APN	2	40637753	missense	probably benign	0.04
IGL03129:Lrp1b	APN	2	41312466	splice site	probably benign
IGL03166:Lrp1b	APN	2	41111038	missense	probably damaging	1.00
IGL03170:Lrp1b	APN	2	40697444	missense	unknown
IGL03195:Lrp1b	APN	2	41471122	missense	possibly damaging	0.95
IGL03224:Lrp1b	APN	2	41471031	missense	possibly damaging	0.92
IGL03251:Lrp1b	APN	2	40600267	missense	probably benign	0.20
IGL03281:Lrp1b	APN	2	40725514	missense	probably benign	0.01
IGL03295:Lrp1b	APN	2	40678987	splice site	probably null
IGL03340:Lrp1b	APN	2	41468969	missense	probably damaging	0.97
IGL03391:Lrp1b	APN	2	41295641	missense	possibly damaging	0.95
IGL03401:Lrp1b	APN	2	41110778	missense	probably benign	0.18
IGL03403:Lrp1b	APN	2	40702824	missense	probably benign	0.16
IGL03408:Lrp1b	APN	2	40858582	missense	probably damaging	0.97
Fetching	UTSW	2	40879555	missense	probably benign	0.00
Heiden	UTSW	2	40637775	missense	probably benign	0.00
hither	UTSW	2	40702848	missense	probably benign	0.00
Roeslein	UTSW	2	40725907	missense	probably damaging	1.00
I2288:Lrp1b	UTSW	2	41122932	missense	probably damaging	0.99
I2289:Lrp1b	UTSW	2	41122932	missense	probably damaging	0.99
LCD18:Lrp1b	UTSW	2	42237562	intron	probably benign
PIT4431001:Lrp1b	UTSW	2	41004755	missense
PIT4585001:Lrp1b	UTSW	2	41269204	missense
R0022:Lrp1b	UTSW	2	40998038	splice site	probably benign
R0022:Lrp1b	UTSW	2	40998038	splice site	probably benign
R0054:Lrp1b	UTSW	2	40742817	missense	probably benign	0.11
R0054:Lrp1b	UTSW	2	40742817	missense	probably benign	0.11
R0094:Lrp1b	UTSW	2	41282030	unclassified	probably benign
R0102:Lrp1b	UTSW	2	41408985	splice site	probably benign
R0123:Lrp1b	UTSW	2	40596983	missense	probably damaging	1.00
R0128:Lrp1b	UTSW	2	41511508	missense	probably damaging	1.00
R0130:Lrp1b	UTSW	2	41511508	missense	probably damaging	1.00
R0134:Lrp1b	UTSW	2	40596983	missense	probably damaging	1.00
R0135:Lrp1b	UTSW	2	41269239	missense	probably damaging	0.99
R0153:Lrp1b	UTSW	2	41123019	missense	possibly damaging	0.92
R0178:Lrp1b	UTSW	2	40725907	missense	probably damaging	1.00
R0225:Lrp1b	UTSW	2	40596983	missense	probably damaging	1.00
R0242:Lrp1b	UTSW	2	40998183	missense	probably benign	0.01
R0242:Lrp1b	UTSW	2	40998183	missense	probably benign	0.01
R0312:Lrp1b	UTSW	2	41282171	missense	probably damaging	1.00
R0325:Lrp1b	UTSW	2	40851711	missense	probably damaging	1.00
R0330:Lrp1b	UTSW	2	40701761	nonsense	probably null
R0372:Lrp1b	UTSW	2	40730798	missense	probably benign	0.30
R0400:Lrp1b	UTSW	2	40750914	missense	probably benign	0.40
R0408:Lrp1b	UTSW	2	40677591	missense	probably damaging	1.00
R0498:Lrp1b	UTSW	2	41458405	missense	probably benign	0.19
R0563:Lrp1b	UTSW	2	40750914	missense	probably benign	0.40
R0569:Lrp1b	UTSW	2	40889239	missense	probably benign	0.11
R0622:Lrp1b	UTSW	2	41728551	critical splice donor site	probably null
R0682:Lrp1b	UTSW	2	41295641	missense	probably benign	0.01
R0727:Lrp1b	UTSW	2	40750944	missense	probably benign	0.40
R0747:Lrp1b	UTSW	2	40870341	missense	probably damaging	1.00
R0761:Lrp1b	UTSW	2	41185935	missense	probably damaging	0.99
R0905:Lrp1b	UTSW	2	41284185	missense	probably damaging	1.00
R0959:Lrp1b	UTSW	2	41268354	missense	possibly damaging	0.83
R1124:Lrp1b	UTSW	2	40875051	missense	probably damaging	1.00
R1158:Lrp1b	UTSW	2	40677494	missense	unknown
R1265:Lrp1b	UTSW	2	41476654	missense	probably damaging	1.00
R1276:Lrp1b	UTSW	2	41728576	missense	probably benign	0.35
R1277:Lrp1b	UTSW	2	40725945	missense	probably benign
R1282:Lrp1b	UTSW	2	40860761	missense	probably damaging	1.00
R1291:Lrp1b	UTSW	2	41341895	missense	probably benign	0.05
R1316:Lrp1b	UTSW	2	40702804	missense	probably benign
R1340:Lrp1b	UTSW	2	40702794	missense	probably benign	0.02
R1371:Lrp1b	UTSW	2	40647153	missense	probably damaging	1.00
R1415:Lrp1b	UTSW	2	40629664	missense	probably damaging	1.00
R1416:Lrp1b	UTSW	2	40998216	missense	probably damaging	1.00
R1417:Lrp1b	UTSW	2	41004641	missense	probably benign	0.14
R1465:Lrp1b	UTSW	2	41111059	missense	probably benign	0.00
R1465:Lrp1b	UTSW	2	41111059	missense	probably benign	0.00
R1467:Lrp1b	UTSW	2	40657356	splice site	probably benign
R1468:Lrp1b	UTSW	2	40927829	critical splice donor site	probably null
R1468:Lrp1b	UTSW	2	40927829	critical splice donor site	probably null
R1480:Lrp1b	UTSW	2	40903389	missense	probably damaging	1.00
R1488:Lrp1b	UTSW	2	41502024	missense	probably benign	0.01
R1496:Lrp1b	UTSW	2	42323662	missense	probably damaging	0.98
R1542:Lrp1b	UTSW	2	41123712	missense	probably damaging	1.00
R1571:Lrp1b	UTSW	2	41476646	missense	probably damaging	1.00
R1598:Lrp1b	UTSW	2	41511478	missense	probably damaging	1.00
R1619:Lrp1b	UTSW	2	40697589	missense	unknown
R1697:Lrp1b	UTSW	2	40822683	missense	probably damaging	0.99
R1698:Lrp1b	UTSW	2	40851806	nonsense	probably null
R1699:Lrp1b	UTSW	2	41185962	missense	possibly damaging	0.91
R1715:Lrp1b	UTSW	2	41185981	missense	probably damaging	1.00
R1748:Lrp1b	UTSW	2	41728706	missense	possibly damaging	0.56
R1756:Lrp1b	UTSW	2	41110825	missense	probably damaging	1.00
R1889:Lrp1b	UTSW	2	40919167	nonsense	probably null
R1895:Lrp1b	UTSW	2	40665147	missense	unknown
R1902:Lrp1b	UTSW	2	40860661	missense	probably damaging	1.00
R1919:Lrp1b	UTSW	2	41728729	missense	probably benign	0.00
R1939:Lrp1b	UTSW	2	40697589	missense	unknown
R1946:Lrp1b	UTSW	2	40665147	missense	unknown
R1954:Lrp1b	UTSW	2	40858441	missense	probably damaging	1.00
R1970:Lrp1b	UTSW	2	40875069	missense	probably damaging	1.00
R1983:Lrp1b	UTSW	2	41511404	critical splice donor site	probably null
R2029:Lrp1b	UTSW	2	41341849	missense	probably benign	0.02
R2054:Lrp1b	UTSW	2	40697482	missense	unknown
R2108:Lrp1b	UTSW	2	41110757	missense	probably damaging	1.00
R2158:Lrp1b	UTSW	2	40879555	missense	probably benign	0.00
R2168:Lrp1b	UTSW	2	41375846	missense	probably damaging	1.00
R2184:Lrp1b	UTSW	2	40730702	missense	probably benign
R2188:Lrp1b	UTSW	2	41408959	missense	probably benign	0.25
R2200:Lrp1b	UTSW	2	41284165	missense	probably benign	0.43
R2342:Lrp1b	UTSW	2	40919196	missense	possibly damaging	0.89
R2421:Lrp1b	UTSW	2	40882133	splice site	probably benign
R2656:Lrp1b	UTSW	2	41511581	missense	probably damaging	0.99
R2864:Lrp1b	UTSW	2	40874995	missense	possibly damaging	0.92
R2874:Lrp1b	UTSW	2	40851693	missense	probably damaging	1.00
R2911:Lrp1b	UTSW	2	41506692	missense	probably benign	0.00
R2919:Lrp1b	UTSW	2	41770899	missense	probably damaging	1.00
R3027:Lrp1b	UTSW	2	40870271	missense	probably benign	0.33
R3083:Lrp1b	UTSW	2	40600324	missense	probably damaging	0.99
R3545:Lrp1b	UTSW	2	40600288	missense	probably damaging	1.00
R3546:Lrp1b	UTSW	2	40600288	missense	probably damaging	1.00
R3547:Lrp1b	UTSW	2	40600288	missense	probably damaging	1.00
R3709:Lrp1b	UTSW	2	40697442	missense	unknown
R3817:Lrp1b	UTSW	2	40876658	missense	probably damaging	1.00
R3876:Lrp1b	UTSW	2	41445194	missense	probably damaging	1.00
R3877:Lrp1b	UTSW	2	41445194	missense	probably damaging	1.00
R3896:Lrp1b	UTSW	2	40922428	splice site	probably null
R3901:Lrp1b	UTSW	2	40822695	missense	probably damaging	1.00
R3915:Lrp1b	UTSW	2	41449236	missense	probably damaging	1.00
R3922:Lrp1b	UTSW	2	40677581	missense	unknown
R3964:Lrp1b	UTSW	2	41312470	splice site	probably benign
R4013:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4014:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4015:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4017:Lrp1b	UTSW	2	40802984	missense	possibly damaging	0.66
R4031:Lrp1b	UTSW	2	40702848	missense	probably benign	0.00
R4095:Lrp1b	UTSW	2	41449191	missense	probably benign	0.03
R4108:Lrp1b	UTSW	2	40665087	missense	unknown
R4176:Lrp1b	UTSW	2	41408393	missense	probably damaging	1.00
R4181:Lrp1b	UTSW	2	40611434	missense	probably damaging	1.00
R4359:Lrp1b	UTSW	2	40903065	missense	probably damaging	1.00
R4410:Lrp1b	UTSW	2	40665082	missense	possibly damaging	0.96
R4416:Lrp1b	UTSW	2	40663667	missense	unknown
R4489:Lrp1b	UTSW	2	40661489	unclassified	probably benign
R4577:Lrp1b	UTSW	2	40821719	missense	probably damaging	1.00
R4623:Lrp1b	UTSW	2	41246021	missense	probably damaging	1.00
R4677:Lrp1b	UTSW	2	40801484	missense	probably damaging	1.00
R4684:Lrp1b	UTSW	2	40922304	missense	probably benign	0.44
R4714:Lrp1b	UTSW	2	41110759	missense	possibly damaging	0.90
R4721:Lrp1b	UTSW	2	40715369	splice site	probably null
R4755:Lrp1b	UTSW	2	41269273	missense	probably benign	0.07
R4755:Lrp1b	UTSW	2	41471016	missense	probably benign
R4774:Lrp1b	UTSW	2	40661532	missense	probably null	1.00
R4854:Lrp1b	UTSW	2	41111077	missense	probably damaging	1.00
R4880:Lrp1b	UTSW	2	41770919	missense	probably benign	0.07
R4885:Lrp1b	UTSW	2	41468893	missense	probably benign
R4901:Lrp1b	UTSW	2	40821645	missense	probably damaging	1.00
R4919:Lrp1b	UTSW	2	40647234	missense	probably benign	0.25
R4935:Lrp1b	UTSW	2	41498393	missense	probably benign	0.01
R4937:Lrp1b	UTSW	2	40802885	splice site	probably null
R4967:Lrp1b	UTSW	2	41788974	missense	probably damaging	1.00
R4968:Lrp1b	UTSW	2	40702707	splice site	probably null
R4968:Lrp1b	UTSW	2	41789062	missense	probably damaging	1.00
R5155:Lrp1b	UTSW	2	41728622	splice site	probably null
R5221:Lrp1b	UTSW	2	41112982	missense	possibly damaging	0.79
R5224:Lrp1b	UTSW	2	41110840	missense	possibly damaging	0.61
R5227:Lrp1b	UTSW	2	40851793	missense	possibly damaging	0.95
R5246:Lrp1b	UTSW	2	41470940	critical splice donor site	probably null
R5263:Lrp1b	UTSW	2	41960679	missense	probably damaging	1.00
R5274:Lrp1b	UTSW	2	41344444	missense	probably null	1.00
R5291:Lrp1b	UTSW	2	40903003	missense	probably damaging	1.00
R5362:Lrp1b	UTSW	2	41375902	missense	probably damaging	1.00
R5365:Lrp1b	UTSW	2	40647125	missense	possibly damaging	0.55
R5369:Lrp1b	UTSW	2	41004613	nonsense	probably null
R5419:Lrp1b	UTSW	2	40730704	nonsense	probably null
R5434:Lrp1b	UTSW	2	41770868	missense	probably damaging	0.96
R5452:Lrp1b	UTSW	2	40922316	missense	probably damaging	1.00
R5453:Lrp1b	UTSW	2	41282237	missense	probably damaging	1.00
R5496:Lrp1b	UTSW	2	40927973	missense	probably benign	0.02
R5524:Lrp1b	UTSW	2	41110888	missense	probably damaging	1.00
R5538:Lrp1b	UTSW	2	40697474	missense	unknown
R5571:Lrp1b	UTSW	2	41408342	missense	probably damaging	0.97
R5577:Lrp1b	UTSW	2	40875123	missense	possibly damaging	0.70
R5609:Lrp1b	UTSW	2	41341795	missense	probably damaging	1.00
R5635:Lrp1b	UTSW	2	42652822	utr 5 prime	probably benign
R5669:Lrp1b	UTSW	2	41111038	missense	probably damaging	1.00
R5672:Lrp1b	UTSW	2	41341759	missense	probably benign	0.01
R5690:Lrp1b	UTSW	2	40750894	splice site	probably null
R5752:Lrp1b	UTSW	2	41295612	missense	probably damaging	1.00
R5853:Lrp1b	UTSW	2	40663726	missense	unknown
R5869:Lrp1b	UTSW	2	41004603	missense	probably damaging	0.98
R5880:Lrp1b	UTSW	2	41341814	missense	probably benign	0.23
R5887:Lrp1b	UTSW	2	40821707	missense	possibly damaging	0.91
R5893:Lrp1b	UTSW	2	40601587	missense	probably damaging	1.00
R5894:Lrp1b	UTSW	2	41498221	missense	probably benign	0.11
R6019:Lrp1b	UTSW	2	41302970	missense	probably damaging	1.00
R6019:Lrp1b	UTSW	2	41476809	missense	probably damaging	1.00
R6021:Lrp1b	UTSW	2	41344427	missense	probably benign	0.02
R6045:Lrp1b	UTSW	2	40701813	missense	unknown
R6047:Lrp1b	UTSW	2	40637775	missense	probably benign	0.00
R6060:Lrp1b	UTSW	2	40750934	missense
R6063:Lrp1b	UTSW	2	41284144	nonsense	probably null
R6090:Lrp1b	UTSW	2	41185868	critical splice donor site	probably null
R6112:Lrp1b	UTSW	2	41341882	missense	probably benign	0.14
R6128:Lrp1b	UTSW	2	40860655	missense	probably benign
R6149:Lrp1b	UTSW	2	40875153	splice site	probably null
R6174:Lrp1b	UTSW	2	41449263	missense	probably benign
R6177:Lrp1b	UTSW	2	41123736	splice site	probably null
R6257:Lrp1b	UTSW	2	40596969	splice site	probably null
R6267:Lrp1b	UTSW	2	40657525	missense	probably benign	0.00
R6268:Lrp1b	UTSW	2	40821717	missense	probably benign	0.01
R6331:Lrp1b	UTSW	2	40803209	missense	probably damaging	1.00
R6334:Lrp1b	UTSW	2	41789033	missense	probably benign
R6359:Lrp1b	UTSW	2	41295596	missense	probably damaging	1.00
R6371:Lrp1b	UTSW	2	40851654	missense	possibly damaging	0.61
R6421:Lrp1b	UTSW	2	40889270	missense	probably damaging	1.00
R6524:Lrp1b	UTSW	2	40851804	missense	possibly damaging	0.95
R6616:Lrp1b	UTSW	2	40699631	missense	unknown
R6632:Lrp1b	UTSW	2	40725442	missense	probably benign	0.23
R6656:Lrp1b	UTSW	2	40637864	nonsense	probably null
R6698:Lrp1b	UTSW	2	41302946	missense	probably damaging	1.00
R6741:Lrp1b	UTSW	2	41245989	missense	possibly damaging	0.82
R6742:Lrp1b	UTSW	2	41471120	missense	probably benign	0.31
R6811:Lrp1b	UTSW	2	40715500	splice site	probably null
R6811:Lrp1b	UTSW	2	41449194	missense	probably benign	0.01
R6855:Lrp1b	UTSW	2	40628696	missense	possibly damaging	0.66
R6888:Lrp1b	UTSW	2	41471126	missense	probably benign	0.18
R6946:Lrp1b	UTSW	2	40697439	missense	probably benign
R6984:Lrp1b	UTSW	2	40822628	missense	probably damaging	0.97
R7026:Lrp1b	UTSW	2	41269222	missense	probably damaging	1.00
R7028:Lrp1b	UTSW	2	41246011	missense	probably benign	0.45
R7036:Lrp1b	UTSW	2	41112342	missense	possibly damaging	0.89
R7043:Lrp1b	UTSW	2	40922414	missense	possibly damaging	0.84
R7071:Lrp1b	UTSW	2	41408264	missense
R7077:Lrp1b	UTSW	2	41770846	missense
R7115:Lrp1b	UTSW	2	40998235	missense
R7146:Lrp1b	UTSW	2	41375994	nonsense	probably null
R7149:Lrp1b	UTSW	2	40637860	missense
R7185:Lrp1b	UTSW	2	40801512	critical splice acceptor site	probably null
R7239:Lrp1b	UTSW	2	41004713	missense
R7247:Lrp1b	UTSW	2	41269212	missense
R7331:Lrp1b	UTSW	2	40663610	splice site	probably null
R7369:Lrp1b	UTSW	2	41282039	missense
R7378:Lrp1b	UTSW	2	41295669	missense
R7381:Lrp1b	UTSW	2	40802917	missense
R7406:Lrp1b	UTSW	2	41376018	critical splice acceptor site	probably null
R7437:Lrp1b	UTSW	2	40822645	missense
R7437:Lrp1b	UTSW	2	40822646	missense
R7446:Lrp1b	UTSW	2	41671057	missense
R7460:Lrp1b	UTSW	2	40598466	missense
R7462:Lrp1b	UTSW	2	41113029	missense
R7475:Lrp1b	UTSW	2	41344576	missense
R7479:Lrp1b	UTSW	2	40801505	missense
R7523:Lrp1b	UTSW	2	41511461	missense
R7525:Lrp1b	UTSW	2	40657416	missense
R7549:Lrp1b	UTSW	2	40875122	missense
R7552:Lrp1b	UTSW	2	40677570	missense
R7558:Lrp1b	UTSW	2	41341936	missense
R7587:Lrp1b	UTSW	2	40730717	missense
R7599:Lrp1b	UTSW	2	40661549	missense
R7635:Lrp1b	UTSW	2	41123597	critical splice donor site	probably null
R7663:Lrp1b	UTSW	2	42653035	unclassified	probably benign
R7674:Lrp1b	UTSW	2	42652909	start gained	probably benign
R7681:Lrp1b	UTSW	2	40874999	nonsense	probably null
R7703:Lrp1b	UTSW	2	41110786	missense
R7742:Lrp1b	UTSW	2	40822629	missense
R7767:Lrp1b	UTSW	2	40801505	missense
R7829:Lrp1b	UTSW	2	40903448	nonsense	probably null
R7861:Lrp1b	UTSW	2	40697558	missense
R7868:Lrp1b	UTSW	2	41449234	missense
R7883:Lrp1b	UTSW	2	40665129	missense
R7956:Lrp1b	UTSW	2	41282149	splice site	probably null
R7963:Lrp1b	UTSW	2	40927935	missense
R7964:Lrp1b	UTSW	2	40598511	missense
R8035:Lrp1b	UTSW	2	40860655	missense
R8046:Lrp1b	UTSW	2	41269187	missense
R8128:Lrp1b	UTSW	2	41269236	missense	probably null
R8234:Lrp1b	UTSW	2	41312656	missense
R8237:Lrp1b	UTSW	2	40851774	missense
R8244:Lrp1b	UTSW	2	41506782	missense
R8370:Lrp1b	UTSW	2	40998105	missense
R8395:Lrp1b	UTSW	2	40657399	missense
R8398:Lrp1b	UTSW	2	40701807	missense
R8421:Lrp1b	UTSW	2	40725423	missense
R8426:Lrp1b	UTSW	2	41498306	missense
R8443:Lrp1b	UTSW	2	41375855	nonsense	probably null
R8444:Lrp1b	UTSW	2	40870260	missense
R8486:Lrp1b	UTSW	2	41728690	missense	probably damaging	1.00
R8500:Lrp1b	UTSW	2	41506779	missense	probably benign	0.12
R8507:Lrp1b	UTSW	2	41408375	missense
R8552:Lrp1b	UTSW	2	41408981	missense	probably benign	0.00
R8554:Lrp1b	UTSW	2	41344483	missense	probably benign	0.28
R8669:Lrp1b	UTSW	2	41282035	critical splice donor site	probably null
R8699:Lrp1b	UTSW	2	41282195	missense
R8796:Lrp1b	UTSW	2	40903414	missense
R8815:Lrp1b	UTSW	2	40665159	missense
R8842:Lrp1b	UTSW	2	41268405	missense
R8858:Lrp1b	UTSW	2	41670815	intron	probably benign
R8864:Lrp1b	UTSW	2	41112706	missense
R8918:Lrp1b	UTSW	2	40725881	missense
R8920:Lrp1b	UTSW	2	42323598	missense
R8963:Lrp1b	UTSW	2	40998184	missense	probably benign	0.28
R8971:Lrp1b	UTSW	2	41435628	missense
R9007:Lrp1b	UTSW	2	40697552	missense
R9042:Lrp1b	UTSW	2	41502017	missense
R9053:Lrp1b	UTSW	2	40858489	missense
R9063:Lrp1b	UTSW	2	41341826	missense
R9072:Lrp1b	UTSW	2	40725445	nonsense	probably null
R9105:Lrp1b	UTSW	2	41506791	missense
R9131:Lrp1b	UTSW	2	40699578	nonsense	probably null
R9226:Lrp1b	UTSW	2	41511448	missense
R9245:Lrp1b	UTSW	2	40598444	missense
R9275:Lrp1b	UTSW	2	40597064	missense
R9278:Lrp1b	UTSW	2	40597064	missense
R9303:Lrp1b	UTSW	2	41728562	missense
R9305:Lrp1b	UTSW	2	41728562	missense
R9306:Lrp1b	UTSW	2	40628750	missense	possibly damaging	0.66
R9320:Lrp1b	UTSW	2	41445099	critical splice donor site	probably null
R9330:Lrp1b	UTSW	2	41122981	missense
R9352:Lrp1b	UTSW	2	40858426	missense
R9386:Lrp1b	UTSW	2	41123628	missense
R9397:Lrp1b	UTSW	2	40750910	missense
R9444:Lrp1b	UTSW	2	41123718	missense
R9452:Lrp1b	UTSW	2	41960714	nonsense	probably null
R9474:Lrp1b	UTSW	2	40601587	missense	probably damaging	1.00
R9501:Lrp1b	UTSW	2	41282235	missense
R9523:Lrp1b	UTSW	2	41770966	missense
R9541:Lrp1b	UTSW	2	41344588	missense
R9555:Lrp1b	UTSW	2	40851681	missense
R9555:Lrp1b	UTSW	2	40858426	missense
R9563:Lrp1b	UTSW	2	41295699	missense
R9568:Lrp1b	UTSW	2	40679215	missense
R9622:Lrp1b	UTSW	2	40889342	nonsense	probably null
R9623:Lrp1b	UTSW	2	41476636	missense
R9634:Lrp1b	UTSW	2	41245939	critical splice donor site	probably null
R9640:Lrp1b	UTSW	2	41188917	missense
R9664:Lrp1b	UTSW	2	40874992	missense
R9668:Lrp1b	UTSW	2	41185970	missense
R9672:Lrp1b	UTSW	2	40889279	missense
R9717:Lrp1b	UTSW	2	41268383	missense
R9741:Lrp1b	UTSW	2	41112288	missense
RF018:Lrp1b	UTSW	2	41110907	missense
RF020:Lrp1b	UTSW	2	41770846	missense
V1662:Lrp1b	UTSW	2	41122932	missense	probably damaging	0.99
X0028:Lrp1b	UTSW	2	41471145	missense	probably damaging	1.00
X0064:Lrp1b	UTSW	2	41502043	missense	probably damaging	1.00
Z1176:Lrp1b	UTSW	2	40677506	missense
Z1176:Lrp1b	UTSW	2	40697582	missense
Z1176:Lrp1b	UTSW	2	40922383	missense
Z1176:Lrp1b	UTSW	2	41728710	missense
Z1177:Lrp1b	UTSW	2	40637749	missense
Z1177:Lrp1b	UTSW	2	41188848	missense
Z1187:Lrp1b	UTSW	2	40750934	missense
Z1188:Lrp1b	UTSW	2	40750934	missense

Predicted Primers

PCR Primer
(F):5'- TGTAGTCGTACACATACCTCCACTC -3'
(R):5'- CCTTTATGACTTATGGCTTATCTGG -3'

Sequencing Primer
(F):5'- GTACACATACCTCCACTCTCTGACAG -3'
(R):5'- GGCTTATCTGGCTATAAGAACAAAGC -3'

Posted On

2019-05-15