Mutagenetix > Incidental Mutations

Incidental Mutation 'R7143:Agl'

553522

Institutional Source

Beutler Lab

Gene Symbol

Agl

Ensembl Gene

ENSMUSG00000033400

Gene Name

amylo-1,6-glucosidase, 4-alpha-glucanotransferase

Synonyms

9430004C13Rik, 9630046L06Rik, 1110061O17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R7143 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116739999-116808166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 116792021 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 153 (S153P)

Ref Sequence

ENSEMBL: ENSMUSP00000143582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159670] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040603
AA Change: S153P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: S153P

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	31	116	4.8e-24	PFAM
Pfam:hDGE_amylase	120	550	9.6e-167	PFAM
Pfam:hGDE_central	697	974	2e-90	PFAM
Pfam:GDE_C	1044	1527	8.5e-145	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159670

SMART Domains

Protein: ENSMUSP00000124840
Gene: ENSMUSG00000033400

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	30	117	7.9e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159742
AA Change: S153P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: S153P

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	31	116	2.1e-20	PFAM
Pfam:hDGE_amylase	120	550	7.8e-164	PFAM
Pfam:hGDE_central	697	974	6.2e-87	PFAM
Pfam:GDE_C	1043	1279	6.7e-61	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000161336
AA Change: S153P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400
AA Change: S153P

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	30	117	2.1e-29	PFAM
Pfam:hDGE_amylase	120	230	3.7e-43	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000162792
AA Change: S153P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: S153P

Domain	Start	End	E-Value	Type
Pfam:hGDE_N	30	117	4e-28	PFAM
Pfam:hDGE_amylase	120	550	1.4e-167	PFAM
Pfam:hGDE_central	697	975	5.6e-95	PFAM
Pfam:GDE_C	1061	1527	1.1e-137	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	C	T	7: 104,059,215	C129Y	probably damaging	Het
Agbl4	A	G	4: 111,617,136	N374S	probably damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Ankrd17	C	A	5: 90,285,961	A650S	possibly damaging	Het
Ankrd53	A	G	6: 83,762,911	R16G	possibly damaging	Het
Apba2	T	C	7: 64,744,417	L570P	probably damaging	Het
Asap1	A	G	15: 64,191,528	F101L	probably damaging	Het
Cadm4	T	A	7: 24,499,567	I89N	possibly damaging	Het
Cadps	C	T	14: 12,491,838	V771I	probably benign	Het
Cenph	A	G	13: 100,761,777	V206A	possibly damaging	Het
Cenpn	A	G	8: 116,937,227	T253A	probably benign	Het
Cep120	C	T	18: 53,683,385	G939R	probably benign	Het
Cfap57	G	A	4: 118,620,709		probably benign	Het
Clip1	T	C	5: 123,653,610	I166V	probably benign	Het
Cstf3	T	A	2: 104,646,616	V144E	probably benign	Het
Cyp21a1	T	A	17: 34,802,326	H357L	probably damaging	Het
Cyth3	T	A	5: 143,684,396	V12E	unknown	Het
Dgat2	T	C	7: 99,157,124	I289V	probably benign	Het
Dip2a	A	G	10: 76,297,791	C527R	probably damaging	Het
Dnah17	A	C	11: 118,086,130	W1879G	probably damaging	Het
Dnaic2	A	G	11: 114,754,250	T504A	possibly damaging	Het
Efl1	C	T	7: 82,762,680	P759L	probably damaging	Het
Egfr	A	C	11: 16,871,627	I351L	probably benign	Het
Ercc6	G	A	14: 32,570,305	E1209K	probably damaging	Het
Fam135b	A	T	15: 71,479,151	M292K	probably benign	Het
Fbxl7	C	A	15: 26,543,158	V468L	probably benign	Het
Fhl2	G	T	1: 43,141,851	H60N	probably damaging	Het
G6pc	G	T	11: 101,370,723	R83L	probably damaging	Het
Gata4	C	A	14: 63,204,617	R252L	probably damaging	Het
Glt8d1	T	A	14: 31,006,645	I10N	probably damaging	Het
Gm10471	T	A	5: 26,085,676	I166F	probably benign	Het
Gm10803	T	A	2: 93,563,959	Y25*	probably null	Het
Gm19345	T	C	7: 19,857,834	F108S	unknown	Het
Gm4952	A	G	19: 12,618,407	T54A	possibly damaging	Het
Gprc6a	C	T	10: 51,614,890	R921H	probably benign	Het
Hc	A	T	2: 35,050,438	H129Q	probably benign	Het
Heatr5a	T	C	12: 51,961,468	R31G	probably benign	Het
Hephl1	T	C	9: 15,060,810	K945E	possibly damaging	Het
Ik	G	T	18: 36,751,177	M237I	probably damaging	Het
Izumo1	T	A	7: 45,627,095	S361T	probably benign	Het
Kcnq4	A	G	4: 120,711,239	F427L	probably benign	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Kifap3	T	A	1: 163,856,040	M430K	possibly damaging	Het
Lamb3	A	G	1: 193,304,565	E53G	probably damaging	Het
Lrp1b	A	T	2: 41,312,643	I1266K		Het
Nat8	A	T	6: 85,830,503	I216K	probably benign	Het
Ncapd2	T	C	6: 125,179,561	I454V	probably benign	Het
Nlrp4f	A	T	13: 65,195,306	V153E	probably damaging	Het
Nlrp4f	G	C	13: 65,199,352	Q9E	possibly damaging	Het
Npy2r	A	T	3: 82,540,943	I175N	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1247	T	C	2: 89,610,019	M28V	probably benign	Het
Olfr364-ps1	A	G	2: 37,146,874	T221A	probably benign	Het
Olfr665	C	T	7: 104,881,186	P160S	probably damaging	Het
Pcdh9	T	C	14: 93,888,272	N154S	probably damaging	Het
Pcdhb2	A	T	18: 37,295,881	E302D	probably benign	Het
Pclo	T	A	5: 14,858,822	V5048E	unknown	Het
Pcnt	A	G	10: 76,389,060	L1870S	possibly damaging	Het
Pigc	T	C	1: 161,970,592	Y48H	probably damaging	Het
Pisd	C	T	5: 32,738,502	V241I	possibly damaging	Het
Pkhd1l1	A	T	15: 44,573,637	M3464L	possibly damaging	Het
Pofut2	T	A	10: 77,259,426	I35N	probably benign	Het
Prss27	A	G	17: 24,045,658	Y265C	probably damaging	Het
Prss56	T	A	1: 87,188,153	I583K	probably benign	Het
Rnpep	T	C	1: 135,283,749	E87G	probably benign	Het
Shtn1	T	C	19: 59,018,906	H304R	probably damaging	Het
Slc23a4	A	T	6: 34,978,913	I62N	probably damaging	Het
Slc35e2	A	T	4: 155,618,594	I355F	probably benign	Het
Snx25	T	C	8: 46,035,715	I868V	possibly damaging	Het
Spatc1l	T	A	10: 76,569,931	L323Q	probably damaging	Het
Taok1	A	G	11: 77,537,988	V962A	probably benign	Het
Tas2r140	A	G	6: 133,055,519	I92T	probably benign	Het
Trim17	C	A	11: 58,965,184	Y22*	probably null	Het
Tti1	T	A	2: 158,007,676	M548L	probably benign	Het
Unc93b1	T	C	19: 3,935,204	V4A	unknown	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r225	A	T	17: 20,502,384	Y29F	probably benign	Het
Vmn1r34	A	T	6: 66,637,664	I30N	probably benign	Het
Vmn2r67	T	A	7: 85,152,638	M152L	probably benign	Het
Wdr20rt	T	G	12: 65,225,918	F52V	probably benign	Het
Zfp869	G	T	8: 69,706,656	H422Q	probably damaging	Het

Other mutations in Agl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Agl	APN	3	116771483	missense	probably benign	0.10
IGL00500:Agl	APN	3	116772820	missense	probably damaging	1.00
IGL00691:Agl	APN	3	116779258	missense	possibly damaging	0.46
IGL00711:Agl	APN	3	116793627	missense	probably damaging	1.00
IGL01291:Agl	APN	3	116772789	missense	possibly damaging	0.49
IGL01641:Agl	APN	3	116784455	nonsense	probably null
IGL01860:Agl	APN	3	116772526	splice site	probably benign
IGL01893:Agl	APN	3	116788549	missense	probably damaging	0.97
IGL02193:Agl	APN	3	116779166	missense	probably damaging	0.99
IGL02379:Agl	APN	3	116779091	missense	probably damaging	1.00
IGL02485:Agl	APN	3	116779080	missense	probably benign
IGL02644:Agl	APN	3	116786597	missense	probably damaging	1.00
IGL02673:Agl	APN	3	116781599	missense	probably benign	0.01
IGL02693:Agl	APN	3	116746428	missense	possibly damaging	0.67
IGL02733:Agl	APN	3	116780997	missense	probably benign
IGL03089:Agl	APN	3	116781023	missense	probably damaging	1.00
IGL03271:Agl	APN	3	116779127	missense	probably benign	0.00
ANU05:Agl	UTSW	3	116772789	missense	possibly damaging	0.49
PIT4445001:Agl	UTSW	3	116771460	missense
R0013:Agl	UTSW	3	116776608	nonsense	probably null
R0013:Agl	UTSW	3	116776608	nonsense	probably null
R0022:Agl	UTSW	3	116793836	splice site	probably null
R0092:Agl	UTSW	3	116793804	missense	probably damaging	1.00
R0226:Agl	UTSW	3	116752071	missense	probably damaging	1.00
R0440:Agl	UTSW	3	116758806	missense	probably damaging	1.00
R0488:Agl	UTSW	3	116754962	nonsense	probably null
R0504:Agl	UTSW	3	116786784	missense	probably damaging	0.99
R0689:Agl	UTSW	3	116793628	missense	probably damaging	1.00
R0715:Agl	UTSW	3	116752176	missense	probably damaging	1.00
R0893:Agl	UTSW	3	116753286	missense	probably benign	0.04
R1403:Agl	UTSW	3	116782597	missense	probably benign	0.12
R1403:Agl	UTSW	3	116782597	missense	probably benign	0.12
R1432:Agl	UTSW	3	116746693	missense	probably damaging	1.00
R1465:Agl	UTSW	3	116771372	missense	probably benign	0.35
R1465:Agl	UTSW	3	116771372	missense	probably benign	0.35
R1540:Agl	UTSW	3	116780735	missense	probably benign	0.01
R1624:Agl	UTSW	3	116787246	missense	probably benign	0.30
R1640:Agl	UTSW	3	116752090	missense	probably benign	0.02
R1834:Agl	UTSW	3	116788351	missense	probably benign	0.31
R1853:Agl	UTSW	3	116779322	nonsense	probably null
R2004:Agl	UTSW	3	116781265	missense	probably damaging	1.00
R2184:Agl	UTSW	3	116780777	missense	probably benign	0.00
R2227:Agl	UTSW	3	116788312	missense	possibly damaging	0.78
R3053:Agl	UTSW	3	116791033	missense	probably damaging	1.00
R4181:Agl	UTSW	3	116746630	missense	probably damaging	1.00
R4241:Agl	UTSW	3	116754848	intron	probably benign
R4284:Agl	UTSW	3	116752178	missense	possibly damaging	0.83
R4285:Agl	UTSW	3	116752178	missense	possibly damaging	0.83
R4302:Agl	UTSW	3	116746630	missense	probably damaging	1.00
R4791:Agl	UTSW	3	116786528	critical splice donor site	probably null
R4854:Agl	UTSW	3	116778618	critical splice donor site	probably null
R4968:Agl	UTSW	3	116788526	missense	probably benign	0.31
R5075:Agl	UTSW	3	116793807	missense	probably damaging	1.00
R5219:Agl	UTSW	3	116778721	missense	possibly damaging	0.81
R5274:Agl	UTSW	3	116772486	missense	probably damaging	1.00
R5347:Agl	UTSW	3	116791165	missense	probably damaging	1.00
R5399:Agl	UTSW	3	116781628	missense	probably damaging	1.00
R5511:Agl	UTSW	3	116788560	missense	possibly damaging	0.81
R5763:Agl	UTSW	3	116753360	missense	probably damaging	1.00
R5827:Agl	UTSW	3	116781054	missense	probably damaging	1.00
R5964:Agl	UTSW	3	116793774	missense	probably damaging	1.00
R5967:Agl	UTSW	3	116793708	missense	probably benign	0.06
R5986:Agl	UTSW	3	116772496	missense	probably damaging	1.00
R6127:Agl	UTSW	3	116758329	missense	probably damaging	1.00
R6209:Agl	UTSW	3	116785196	nonsense	probably null
R6252:Agl	UTSW	3	116787229	critical splice donor site	probably null
R6337:Agl	UTSW	3	116786777	missense	possibly damaging	0.65
R6366:Agl	UTSW	3	116791117	missense	probably damaging	1.00
R6441:Agl	UTSW	3	116771459	missense	probably benign	0.21
R6647:Agl	UTSW	3	116750411	missense	probably damaging	1.00
R6678:Agl	UTSW	3	116753320	missense	probably damaging	0.99
R6736:Agl	UTSW	3	116781680	missense	probably damaging	0.98
R7141:Agl	UTSW	3	116753286	missense	probably benign	0.04
R7204:Agl	UTSW	3	116793820	missense	probably benign	0.04
R7259:Agl	UTSW	3	116784581	missense	probably damaging	1.00
R7393:Agl	UTSW	3	116791156	missense	probably benign
R7426:Agl	UTSW	3	116758755	missense
R7559:Agl	UTSW	3	116752115	missense
R7587:Agl	UTSW	3	116792087	missense	probably damaging	1.00
R7609:Agl	UTSW	3	116807279	missense	possibly damaging	0.93
R7657:Agl	UTSW	3	116779163	missense
R7715:Agl	UTSW	3	116758256	missense
X0065:Agl	UTSW	3	116781330	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGCCAATTGCTCCCTTTG -3'
(R):5'- GCCTTTGAGATAGAATCCAACTGAG -3'

Sequencing Primer
(F):5'- TTGTTAACCTGACCCACATAACCTG -3'
(R):5'- ATTTTCCCACTAAGAATGTTCTCG -3'

Posted On

2019-05-15