Incidental Mutation 'R7143:Cfap57'
ID 553524
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 045222-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7143 (G1)
Quality Score 84.0076
Status Not validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 118620709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030501] [ENSMUST00000071972] [ENSMUST00000081921] [ENSMUST00000147373]
AlphaFold Q9D180
Predicted Effect probably benign
Transcript: ENSMUST00000030501
SMART Domains Protein: ENSMUSP00000030501
Gene: ENSMUSG00000028729

DomainStartEndE-ValueType
Pfam:Ebp2 18 298 2.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071972
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147373
SMART Domains Protein: ENSMUSP00000114372
Gene: ENSMUSG00000028729

DomainStartEndE-ValueType
Pfam:Ebp2 13 187 4.8e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 (GRCm38) C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 (GRCm38) N374S probably damaging Het
Agl A G 3: 116,792,021 (GRCm38) S153P probably damaging Het
Akap6 T G 12: 52,887,364 (GRCm38) D546E probably benign Het
Ankrd17 C A 5: 90,285,961 (GRCm38) A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 (GRCm38) R16G possibly damaging Het
Apba2 T C 7: 64,744,417 (GRCm38) L570P probably damaging Het
Asap1 A G 15: 64,191,528 (GRCm38) F101L probably damaging Het
Cadm4 T A 7: 24,499,567 (GRCm38) I89N possibly damaging Het
Cadps C T 14: 12,491,838 (GRCm38) V771I probably benign Het
Cenph A G 13: 100,761,777 (GRCm38) V206A possibly damaging Het
Cenpn A G 8: 116,937,227 (GRCm38) T253A probably benign Het
Cep120 C T 18: 53,683,385 (GRCm38) G939R probably benign Het
Clip1 T C 5: 123,653,610 (GRCm38) I166V probably benign Het
Cstf3 T A 2: 104,646,616 (GRCm38) V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 (GRCm38) H357L probably damaging Het
Cyth3 T A 5: 143,684,396 (GRCm38) V12E unknown Het
Dgat2 T C 7: 99,157,124 (GRCm38) I289V probably benign Het
Dip2a A G 10: 76,297,791 (GRCm38) C527R probably damaging Het
Dnah17 A C 11: 118,086,130 (GRCm38) W1879G probably damaging Het
Dnai2 A G 11: 114,754,250 (GRCm38) T504A possibly damaging Het
Efl1 C T 7: 82,762,680 (GRCm38) P759L probably damaging Het
Egfr A C 11: 16,871,627 (GRCm38) I351L probably benign Het
Ercc6 G A 14: 32,570,305 (GRCm38) E1209K probably damaging Het
Fam135b A T 15: 71,479,151 (GRCm38) M292K probably benign Het
Fbxl7 C A 15: 26,543,158 (GRCm38) V468L probably benign Het
Fhl2 G T 1: 43,141,851 (GRCm38) H60N probably damaging Het
G6pc1 G T 11: 101,370,723 (GRCm38) R83L probably damaging Het
Gata4 C A 14: 63,204,617 (GRCm38) R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 (GRCm38) I10N probably damaging Het
Gm10803 T A 2: 93,563,959 (GRCm38) Y25* probably null Het
Gm19345 T C 7: 19,857,834 (GRCm38) F108S unknown Het
Gm4952 A G 19: 12,618,407 (GRCm38) T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 (GRCm38) R921H probably benign Het
Hc A T 2: 35,050,438 (GRCm38) H129Q probably benign Het
Heatr5a T C 12: 51,961,468 (GRCm38) R31G probably benign Het
Hephl1 T C 9: 15,060,810 (GRCm38) K945E possibly damaging Het
Ik G T 18: 36,751,177 (GRCm38) M237I probably damaging Het
Izumo1 T A 7: 45,627,095 (GRCm38) S361T probably benign Het
Kcnq4 A G 4: 120,711,239 (GRCm38) F427L probably benign Het
Kifap3 T A 1: 163,856,040 (GRCm38) M430K possibly damaging Het
Kifap3 A T 1: 163,825,859 (GRCm38) N338I possibly damaging Het
Lamb3 A G 1: 193,304,565 (GRCm38) E53G probably damaging Het
Lrp1b A T 2: 41,312,643 (GRCm38) I1266K Het
Nat8 A T 6: 85,830,503 (GRCm38) I216K probably benign Het
Ncapd2 T C 6: 125,179,561 (GRCm38) I454V probably benign Het
Nlrp4f G C 13: 65,199,352 (GRCm38) Q9E possibly damaging Het
Nlrp4f A T 13: 65,195,306 (GRCm38) V153E probably damaging Het
Npy2r A T 3: 82,540,943 (GRCm38) I175N probably benign Het
Nutm1 G A 2: 112,250,056 (GRCm38) R505C probably damaging Het
Olfr364-ps1 A G 2: 37,146,874 (GRCm38) T221A probably benign Het
Or4a74 T C 2: 89,610,019 (GRCm38) M28V probably benign Het
Or52n3 C T 7: 104,881,186 (GRCm38) P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 (GRCm38) N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 (GRCm38) E302D probably benign Het
Pclo T A 5: 14,858,822 (GRCm38) V5048E unknown Het
Pcnt A G 10: 76,389,060 (GRCm38) L1870S possibly damaging Het
Pigc T C 1: 161,970,592 (GRCm38) Y48H probably damaging Het
Pisd C T 5: 32,738,502 (GRCm38) V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 (GRCm38) M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 (GRCm38) I35N probably benign Het
Prss27 A G 17: 24,045,658 (GRCm38) Y265C probably damaging Het
Prss56 T A 1: 87,188,153 (GRCm38) I583K probably benign Het
Rnpep T C 1: 135,283,749 (GRCm38) E87G probably benign Het
Shtn1 T C 19: 59,018,906 (GRCm38) H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 (GRCm38) I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 (GRCm38) I355F probably benign Het
Snx25 T C 8: 46,035,715 (GRCm38) I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 (GRCm38) L323Q probably damaging Het
Speer4a2 T A 5: 26,085,676 (GRCm38) I166F probably benign Het
Taok1 A G 11: 77,537,988 (GRCm38) V962A probably benign Het
Tas2r140 A G 6: 133,055,519 (GRCm38) I92T probably benign Het
Trim17 C A 11: 58,965,184 (GRCm38) Y22* probably null Het
Tti1 T A 2: 158,007,676 (GRCm38) M548L probably benign Het
Unc93b1 T C 19: 3,935,204 (GRCm38) V4A unknown Het
Utp3 G C 5: 88,554,517 (GRCm38) probably benign Het
Vmn1r225 A T 17: 20,502,384 (GRCm38) Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 (GRCm38) I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 (GRCm38) M152L probably benign Het
Wdr20rt T G 12: 65,225,918 (GRCm38) F52V probably benign Het
Zfp869 G T 8: 69,706,656 (GRCm38) H422Q probably damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118,581,001 (GRCm38) missense probably benign 0.01
IGL00508:Cfap57 APN 4 118,581,170 (GRCm38) splice site probably null
IGL00857:Cfap57 APN 4 118,612,923 (GRCm38) critical splice donor site probably null
IGL01147:Cfap57 APN 4 118,589,001 (GRCm38) missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118,610,595 (GRCm38) missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118,612,940 (GRCm38) missense probably benign 0.21
IGL01615:Cfap57 APN 4 118,600,796 (GRCm38) missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118,613,017 (GRCm38) missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118,579,372 (GRCm38) missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118,581,105 (GRCm38) missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118,581,105 (GRCm38) missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118,569,348 (GRCm38) critical splice donor site probably null
IGL02800:Cfap57 APN 4 118,614,750 (GRCm38) missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118,584,739 (GRCm38) missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118,599,019 (GRCm38) missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118,576,645 (GRCm38) missense probably benign 0.29
IGL03376:Cfap57 APN 4 118,584,720 (GRCm38) missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118,593,074 (GRCm38) missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118,584,705 (GRCm38) missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118,599,012 (GRCm38) missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118,569,431 (GRCm38) missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118,620,402 (GRCm38) missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118,569,727 (GRCm38) splice site probably benign
R0730:Cfap57 UTSW 4 118,612,920 (GRCm38) splice site probably null
R0737:Cfap57 UTSW 4 118,581,102 (GRCm38) missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118,561,872 (GRCm38) missense probably benign 0.04
R0880:Cfap57 UTSW 4 118,581,838 (GRCm38) nonsense probably null
R1085:Cfap57 UTSW 4 118,595,779 (GRCm38) missense probably benign 0.20
R1119:Cfap57 UTSW 4 118,606,676 (GRCm38) nonsense probably null
R1217:Cfap57 UTSW 4 118,606,652 (GRCm38) missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118,606,534 (GRCm38) critical splice donor site probably null
R1487:Cfap57 UTSW 4 118,614,781 (GRCm38) missense probably benign 0.01
R1676:Cfap57 UTSW 4 118,595,940 (GRCm38) missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118,569,646 (GRCm38) missense probably null 0.20
R1709:Cfap57 UTSW 4 118,571,704 (GRCm38) missense probably benign 0.00
R1719:Cfap57 UTSW 4 118,606,631 (GRCm38) missense probably benign 0.04
R1782:Cfap57 UTSW 4 118,614,975 (GRCm38) missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118,571,724 (GRCm38) missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118,599,894 (GRCm38) missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118,599,927 (GRCm38) missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118,615,010 (GRCm38) missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118,593,132 (GRCm38) missense probably benign 0.03
R2177:Cfap57 UTSW 4 118,606,688 (GRCm38) missense probably benign 0.00
R2322:Cfap57 UTSW 4 118,610,725 (GRCm38) missense probably benign
R3905:Cfap57 UTSW 4 118,595,839 (GRCm38) missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118,593,143 (GRCm38) missense probably benign 0.01
R4079:Cfap57 UTSW 4 118,598,997 (GRCm38) missense probably benign 0.34
R4962:Cfap57 UTSW 4 118,613,065 (GRCm38) missense probably benign 0.21
R4970:Cfap57 UTSW 4 118,620,371 (GRCm38) missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118,593,054 (GRCm38) missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118,595,848 (GRCm38) missense probably benign 0.01
R5482:Cfap57 UTSW 4 118,569,641 (GRCm38) missense probably benign
R5522:Cfap57 UTSW 4 118,595,888 (GRCm38) missense probably benign 0.41
R5626:Cfap57 UTSW 4 118,614,783 (GRCm38) missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118,569,459 (GRCm38) missense probably benign
R5712:Cfap57 UTSW 4 118,614,795 (GRCm38) missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118,571,745 (GRCm38) missense probably benign 0.00
R6244:Cfap57 UTSW 4 118,579,410 (GRCm38) missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118,569,451 (GRCm38) nonsense probably null
R6271:Cfap57 UTSW 4 118,595,759 (GRCm38) missense probably benign 0.13
R6330:Cfap57 UTSW 4 118,569,396 (GRCm38) missense probably benign
R6439:Cfap57 UTSW 4 118,588,975 (GRCm38) critical splice donor site probably null
R6639:Cfap57 UTSW 4 118,554,712 (GRCm38) missense probably benign 0.13
R6722:Cfap57 UTSW 4 118,584,717 (GRCm38) missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118,613,126 (GRCm38) missense possibly damaging 0.67
R7162:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7174:Cfap57 UTSW 4 118,589,067 (GRCm38) missense probably benign 0.35
R7210:Cfap57 UTSW 4 118,576,703 (GRCm38) nonsense probably null
R7242:Cfap57 UTSW 4 118,593,096 (GRCm38) missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118,554,800 (GRCm38) nonsense probably null
R7359:Cfap57 UTSW 4 118,598,965 (GRCm38) missense probably benign 0.01
R7373:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7394:Cfap57 UTSW 4 118,593,137 (GRCm38) missense probably benign 0.00
R7401:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7412:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7414:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7452:Cfap57 UTSW 4 118,595,784 (GRCm38) missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118,589,001 (GRCm38) missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7642:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7741:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7744:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7745:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7842:Cfap57 UTSW 4 118,554,755 (GRCm38) nonsense probably null
R7936:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7940:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R7942:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R8074:Cfap57 UTSW 4 118,569,625 (GRCm38) missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118,593,074 (GRCm38) missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R8447:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R8491:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R8524:Cfap57 UTSW 4 118,614,931 (GRCm38) missense probably benign
R8670:Cfap57 UTSW 4 118,614,925 (GRCm38) missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118,593,006 (GRCm38) missense probably benign 0.04
R8790:Cfap57 UTSW 4 118,581,914 (GRCm38) missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118,569,602 (GRCm38) missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118,554,851 (GRCm38) missense probably benign 0.02
R9212:Cfap57 UTSW 4 118,579,452 (GRCm38) missense possibly damaging 0.95
R9442:Cfap57 UTSW 4 118,606,534 (GRCm38) critical splice donor site probably null
R9525:Cfap57 UTSW 4 118,576,581 (GRCm38) missense probably damaging 1.00
X0022:Cfap57 UTSW 4 118,614,745 (GRCm38) missense probably benign
Z1088:Cfap57 UTSW 4 118,581,882 (GRCm38) missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118,598,956 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCACGGTGGACATGGTAC -3'
(R):5'- ACTCCGAGTCCGACTCTGAAAG -3'

Sequencing Primer
(F):5'- ACGGTGGACATGGTACCTGTC -3'
(R):5'- GTCCGACTCTGAAAGCGGAG -3'
Posted On 2019-05-15