Mutagenetix > Incidental Mutations

Incidental Mutation 'R7143:Cfap57'

553524

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7143 (G1)

Quality Score

84.0076

Status

Not validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 118620709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030501] [ENSMUST00000071972] [ENSMUST00000081921] [ENSMUST00000147373]

AlphaFold

Q9D180

Predicted Effect

probably benign
Transcript: ENSMUST00000030501

SMART Domains

Protein: ENSMUSP00000030501
Gene: ENSMUSG00000028729

Domain	Start	End	E-Value	Type
Pfam:Ebp2	18	298	2.1e-89	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000071972

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147373

SMART Domains

Protein: ENSMUSP00000114372
Gene: ENSMUSG00000028729

Domain	Start	End	E-Value	Type
Pfam:Ebp2	13	187	4.8e-65	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	C	T	7: 104,059,215	C129Y	probably damaging	Het
Agbl4	A	G	4: 111,617,136	N374S	probably damaging	Het
Agl	A	G	3: 116,792,021	S153P	probably damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Ankrd17	C	A	5: 90,285,961	A650S	possibly damaging	Het
Ankrd53	A	G	6: 83,762,911	R16G	possibly damaging	Het
Apba2	T	C	7: 64,744,417	L570P	probably damaging	Het
Asap1	A	G	15: 64,191,528	F101L	probably damaging	Het
Cadm4	T	A	7: 24,499,567	I89N	possibly damaging	Het
Cadps	C	T	14: 12,491,838	V771I	probably benign	Het
Cenph	A	G	13: 100,761,777	V206A	possibly damaging	Het
Cenpn	A	G	8: 116,937,227	T253A	probably benign	Het
Cep120	C	T	18: 53,683,385	G939R	probably benign	Het
Clip1	T	C	5: 123,653,610	I166V	probably benign	Het
Cstf3	T	A	2: 104,646,616	V144E	probably benign	Het
Cyp21a1	T	A	17: 34,802,326	H357L	probably damaging	Het
Cyth3	T	A	5: 143,684,396	V12E	unknown	Het
Dgat2	T	C	7: 99,157,124	I289V	probably benign	Het
Dip2a	A	G	10: 76,297,791	C527R	probably damaging	Het
Dnah17	A	C	11: 118,086,130	W1879G	probably damaging	Het
Dnaic2	A	G	11: 114,754,250	T504A	possibly damaging	Het
Efl1	C	T	7: 82,762,680	P759L	probably damaging	Het
Egfr	A	C	11: 16,871,627	I351L	probably benign	Het
Ercc6	G	A	14: 32,570,305	E1209K	probably damaging	Het
Fam135b	A	T	15: 71,479,151	M292K	probably benign	Het
Fbxl7	C	A	15: 26,543,158	V468L	probably benign	Het
Fhl2	G	T	1: 43,141,851	H60N	probably damaging	Het
G6pc	G	T	11: 101,370,723	R83L	probably damaging	Het
Gata4	C	A	14: 63,204,617	R252L	probably damaging	Het
Glt8d1	T	A	14: 31,006,645	I10N	probably damaging	Het
Gm10471	T	A	5: 26,085,676	I166F	probably benign	Het
Gm10803	T	A	2: 93,563,959	Y25*	probably null	Het
Gm19345	T	C	7: 19,857,834	F108S	unknown	Het
Gm4952	A	G	19: 12,618,407	T54A	possibly damaging	Het
Gprc6a	C	T	10: 51,614,890	R921H	probably benign	Het
Hc	A	T	2: 35,050,438	H129Q	probably benign	Het
Heatr5a	T	C	12: 51,961,468	R31G	probably benign	Het
Hephl1	T	C	9: 15,060,810	K945E	possibly damaging	Het
Ik	G	T	18: 36,751,177	M237I	probably damaging	Het
Izumo1	T	A	7: 45,627,095	S361T	probably benign	Het
Kcnq4	A	G	4: 120,711,239	F427L	probably benign	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Kifap3	T	A	1: 163,856,040	M430K	possibly damaging	Het
Lamb3	A	G	1: 193,304,565	E53G	probably damaging	Het
Lrp1b	A	T	2: 41,312,643	I1266K		Het
Nat8	A	T	6: 85,830,503	I216K	probably benign	Het
Ncapd2	T	C	6: 125,179,561	I454V	probably benign	Het
Nlrp4f	A	T	13: 65,195,306	V153E	probably damaging	Het
Nlrp4f	G	C	13: 65,199,352	Q9E	possibly damaging	Het
Npy2r	A	T	3: 82,540,943	I175N	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1247	T	C	2: 89,610,019	M28V	probably benign	Het
Olfr364-ps1	A	G	2: 37,146,874	T221A	probably benign	Het
Olfr665	C	T	7: 104,881,186	P160S	probably damaging	Het
Pcdh9	T	C	14: 93,888,272	N154S	probably damaging	Het
Pcdhb2	A	T	18: 37,295,881	E302D	probably benign	Het
Pclo	T	A	5: 14,858,822	V5048E	unknown	Het
Pcnt	A	G	10: 76,389,060	L1870S	possibly damaging	Het
Pigc	T	C	1: 161,970,592	Y48H	probably damaging	Het
Pisd	C	T	5: 32,738,502	V241I	possibly damaging	Het
Pkhd1l1	A	T	15: 44,573,637	M3464L	possibly damaging	Het
Pofut2	T	A	10: 77,259,426	I35N	probably benign	Het
Prss27	A	G	17: 24,045,658	Y265C	probably damaging	Het
Prss56	T	A	1: 87,188,153	I583K	probably benign	Het
Rnpep	T	C	1: 135,283,749	E87G	probably benign	Het
Shtn1	T	C	19: 59,018,906	H304R	probably damaging	Het
Slc23a4	A	T	6: 34,978,913	I62N	probably damaging	Het
Slc35e2	A	T	4: 155,618,594	I355F	probably benign	Het
Snx25	T	C	8: 46,035,715	I868V	possibly damaging	Het
Spatc1l	T	A	10: 76,569,931	L323Q	probably damaging	Het
Taok1	A	G	11: 77,537,988	V962A	probably benign	Het
Tas2r140	A	G	6: 133,055,519	I92T	probably benign	Het
Trim17	C	A	11: 58,965,184	Y22*	probably null	Het
Tti1	T	A	2: 158,007,676	M548L	probably benign	Het
Unc93b1	T	C	19: 3,935,204	V4A	unknown	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r225	A	T	17: 20,502,384	Y29F	probably benign	Het
Vmn1r34	A	T	6: 66,637,664	I30N	probably benign	Het
Vmn2r67	T	A	7: 85,152,638	M152L	probably benign	Het
Wdr20rt	T	G	12: 65,225,918	F52V	probably benign	Het
Zfp869	G	T	8: 69,706,656	H422Q	probably damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TACCACGGTGGACATGGTAC -3'
(R):5'- ACTCCGAGTCCGACTCTGAAAG -3'

Sequencing Primer
(F):5'- ACGGTGGACATGGTACCTGTC -3'
(R):5'- GTCCGACTCTGAAAGCGGAG -3'

Posted On

2019-05-15