Incidental Mutation 'R7143:Ankrd17'
ID553531
Institutional Source Beutler Lab
Gene Symbol Ankrd17
Ensembl Gene ENSMUSG00000055204
Gene Nameankyrin repeat domain 17
SynonymsA130069E23Rik, 4933425K22Rik, Gtar
MMRRC Submission
Accession Numbers

Genbank: NM_030886, NM_198010; MGI: 1932101

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location90227166-90366577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90285961 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 650 (A650S)
Ref Sequence ENSEMBL: ENSMUSP00000014421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014421] [ENSMUST00000081914] [ENSMUST00000168058] [ENSMUST00000197021] [ENSMUST00000218526]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014421
AA Change: A650S

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000014421
Gene: ENSMUSG00000055204
AA Change: A650S

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
low complexity region 1597 1611 N/A INTRINSIC
low complexity region 1616 1636 N/A INTRINSIC
KH 1720 1790 8.31e-14 SMART
low complexity region 1816 1827 N/A INTRINSIC
low complexity region 1834 1850 N/A INTRINSIC
low complexity region 1946 1989 N/A INTRINSIC
low complexity region 1996 2024 N/A INTRINSIC
low complexity region 2035 2052 N/A INTRINSIC
low complexity region 2068 2077 N/A INTRINSIC
low complexity region 2086 2110 N/A INTRINSIC
low complexity region 2175 2189 N/A INTRINSIC
low complexity region 2348 2365 N/A INTRINSIC
low complexity region 2392 2411 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081914
AA Change: A650S

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080587
Gene: ENSMUSG00000055204
AA Change: A650S

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
low complexity region 795 809 N/A INTRINSIC
ANK 827 856 2.13e-4 SMART
ANK 860 889 8.19e-6 SMART
ANK 894 923 1.68e-2 SMART
ANK 927 956 1.61e-4 SMART
ANK 962 991 1.43e-5 SMART
ANK 996 1025 1.83e-3 SMART
ANK 1029 1058 3.91e-3 SMART
ANK 1064 1093 1.93e-2 SMART
ANK 1097 1126 8.78e-6 SMART
ANK 1130 1159 7.59e-1 SMART
coiled coil region 1203 1271 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1365 1385 N/A INTRINSIC
KH 1469 1539 8.31e-14 SMART
low complexity region 1565 1576 N/A INTRINSIC
low complexity region 1583 1599 N/A INTRINSIC
low complexity region 1695 1738 N/A INTRINSIC
low complexity region 1745 1773 N/A INTRINSIC
low complexity region 1784 1801 N/A INTRINSIC
low complexity region 1817 1826 N/A INTRINSIC
low complexity region 1835 1859 N/A INTRINSIC
low complexity region 1924 1938 N/A INTRINSIC
low complexity region 2097 2114 N/A INTRINSIC
low complexity region 2141 2160 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000128960
Gene: ENSMUSG00000055204
AA Change: A650S

DomainStartEndE-ValueType
low complexity region 6 40 N/A INTRINSIC
low complexity region 55 71 N/A INTRINSIC
low complexity region 82 130 N/A INTRINSIC
ANK 229 258 8.62e1 SMART
ANK 262 291 3.31e-1 SMART
ANK 296 325 3.51e-5 SMART
ANK 329 358 1.33e-5 SMART
ANK 362 391 3.46e-4 SMART
ANK 396 425 3.23e-4 SMART
ANK 429 458 1.61e-4 SMART
ANK 462 491 1.46e-2 SMART
ANK 495 524 3.88e-7 SMART
ANK 529 558 4.19e-3 SMART
ANK 559 588 1.76e-5 SMART
ANK 592 621 3.51e-5 SMART
ANK 625 654 5.62e-4 SMART
ANK 659 688 1.29e-3 SMART
ANK 692 721 1.44e-1 SMART
coiled coil region 800 883 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
low complexity region 955 968 N/A INTRINSIC
low complexity region 986 997 N/A INTRINSIC
low complexity region 1046 1060 N/A INTRINSIC
ANK 1078 1107 2.13e-4 SMART
ANK 1111 1140 8.19e-6 SMART
ANK 1145 1174 1.68e-2 SMART
ANK 1178 1207 1.61e-4 SMART
ANK 1213 1242 1.43e-5 SMART
ANK 1247 1276 1.83e-3 SMART
ANK 1280 1309 3.91e-3 SMART
ANK 1315 1344 1.93e-2 SMART
ANK 1348 1377 8.78e-6 SMART
ANK 1381 1410 7.59e-1 SMART
coiled coil region 1454 1522 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000197021
AA Change: A541S
SMART Domains Protein: ENSMUSP00000142575
Gene: ENSMUSG00000055204
AA Change: A541S

DomainStartEndE-ValueType
ANK 120 149 5.4e-1 SMART
ANK 153 182 2e-3 SMART
ANK 187 216 2.2e-7 SMART
ANK 220 249 8.2e-8 SMART
ANK 253 282 2.2e-6 SMART
ANK 287 316 2.1e-6 SMART
ANK 320 349 9.9e-7 SMART
ANK 353 382 9.5e-5 SMART
ANK 386 415 2.4e-9 SMART
ANK 420 449 2.6e-5 SMART
ANK 450 479 1.1e-7 SMART
ANK 483 512 2.2e-7 SMART
ANK 516 545 3.5e-6 SMART
ANK 550 579 7.9e-6 SMART
ANK 583 612 8.9e-4 SMART
coiled coil region 691 774 N/A INTRINSIC
low complexity region 781 794 N/A INTRINSIC
low complexity region 846 859 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 937 951 N/A INTRINSIC
ANK 969 998 1.4e-6 SMART
ANK 1002 1031 5.3e-8 SMART
ANK 1036 1065 1e-4 SMART
ANK 1069 1098 1e-6 SMART
ANK 1104 1133 9.1e-8 SMART
ANK 1138 1167 1.2e-5 SMART
ANK 1171 1200 2.5e-5 SMART
ANK 1206 1235 1.2e-4 SMART
ANK 1239 1268 5.5e-8 SMART
ANK 1272 1301 4.7e-3 SMART
coiled coil region 1345 1413 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
KH 1611 1681 5.1e-16 SMART
low complexity region 1707 1718 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1837 1880 N/A INTRINSIC
low complexity region 1887 1915 N/A INTRINSIC
low complexity region 1926 1943 N/A INTRINSIC
low complexity region 1959 1968 N/A INTRINSIC
low complexity region 1977 2001 N/A INTRINSIC
low complexity region 2066 2080 N/A INTRINSIC
low complexity region 2239 2256 N/A INTRINSIC
low complexity region 2283 2302 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218526
AA Change: A650S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 4360512
Lethality: E10-E12
FUNCTION: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with hemorrhages, impaired vascular smooth muscle cell development, impaired vascular integrity, and growth retardation. [provided by MGI curators]
Allele List at MGI

All alleles(133) : Targeted(4) Gene trapped(129)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Ankrd17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ankrd17 APN 5 90233928 missense probably damaging 0.98
IGL00484:Ankrd17 APN 5 90268361 missense probably damaging 0.99
IGL01320:Ankrd17 APN 5 90260129 missense probably damaging 0.99
IGL01776:Ankrd17 APN 5 90283364 nonsense probably null
IGL02093:Ankrd17 APN 5 90242963 missense possibly damaging 0.93
IGL02292:Ankrd17 APN 5 90252859 unclassified probably benign
IGL02302:Ankrd17 APN 5 90283198 missense probably benign 0.23
IGL02472:Ankrd17 APN 5 90264151 missense probably damaging 1.00
IGL02705:Ankrd17 APN 5 90283115 missense probably benign 0.15
IGL02727:Ankrd17 APN 5 90244292 missense possibly damaging 0.93
IGL02884:Ankrd17 APN 5 90264757 missense probably damaging 1.00
3-1:Ankrd17 UTSW 5 90243154 missense probably damaging 0.99
PIT1430001:Ankrd17 UTSW 5 90252973 missense possibly damaging 0.91
R0025:Ankrd17 UTSW 5 90250405 missense probably damaging 0.99
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0076:Ankrd17 UTSW 5 90244406 nonsense probably null
R0271:Ankrd17 UTSW 5 90254799 missense possibly damaging 0.90
R0684:Ankrd17 UTSW 5 90263998 missense probably damaging 0.99
R1239:Ankrd17 UTSW 5 90288676 missense probably damaging 0.99
R1457:Ankrd17 UTSW 5 90285846 missense possibly damaging 0.92
R1505:Ankrd17 UTSW 5 90300026 missense possibly damaging 0.53
R1766:Ankrd17 UTSW 5 90264797 missense possibly damaging 0.95
R1770:Ankrd17 UTSW 5 90243376 missense possibly damaging 0.84
R1780:Ankrd17 UTSW 5 90232415 missense probably damaging 0.96
R1916:Ankrd17 UTSW 5 90260141 missense probably damaging 1.00
R1926:Ankrd17 UTSW 5 90244169 missense probably damaging 1.00
R2090:Ankrd17 UTSW 5 90298046 missense possibly damaging 0.92
R2153:Ankrd17 UTSW 5 90234059 missense probably damaging 0.98
R2279:Ankrd17 UTSW 5 90264717 missense probably damaging 1.00
R2420:Ankrd17 UTSW 5 90289320 missense possibly damaging 0.94
R3012:Ankrd17 UTSW 5 90230868 missense probably damaging 1.00
R3417:Ankrd17 UTSW 5 90243913 missense possibly damaging 0.86
R3704:Ankrd17 UTSW 5 90243969 missense possibly damaging 0.72
R4581:Ankrd17 UTSW 5 90283120 missense possibly damaging 0.67
R4850:Ankrd17 UTSW 5 90264786 missense probably damaging 1.00
R4926:Ankrd17 UTSW 5 90300032 missense probably damaging 1.00
R5023:Ankrd17 UTSW 5 90282868 missense probably damaging 1.00
R5068:Ankrd17 UTSW 5 90254808 missense probably damaging 0.96
R5109:Ankrd17 UTSW 5 90243536 missense possibly damaging 0.83
R5111:Ankrd17 UTSW 5 90242999 missense possibly damaging 0.85
R5214:Ankrd17 UTSW 5 90283460 missense possibly damaging 0.48
R5362:Ankrd17 UTSW 5 90265545 missense probably damaging 1.00
R5576:Ankrd17 UTSW 5 90243224 missense probably benign 0.00
R5615:Ankrd17 UTSW 5 90283436 missense possibly damaging 0.88
R5874:Ankrd17 UTSW 5 90268797 intron probably benign
R5932:Ankrd17 UTSW 5 90265436 missense probably damaging 1.00
R5944:Ankrd17 UTSW 5 90285843 missense probably damaging 1.00
R5993:Ankrd17 UTSW 5 90339672 intron probably benign
R6052:Ankrd17 UTSW 5 90253832 missense probably benign 0.03
R6088:Ankrd17 UTSW 5 90253688 missense possibly damaging 0.95
R6306:Ankrd17 UTSW 5 90244154 missense probably benign 0.03
R6418:Ankrd17 UTSW 5 90278345 missense possibly damaging 0.89
R6663:Ankrd17 UTSW 5 90264064 missense probably damaging 1.00
R6758:Ankrd17 UTSW 5 90263313 missense probably damaging 1.00
R6782:Ankrd17 UTSW 5 90254738 missense possibly damaging 0.91
R6793:Ankrd17 UTSW 5 90265512 missense probably damaging 1.00
R6929:Ankrd17 UTSW 5 90285525 missense possibly damaging 0.86
R7008:Ankrd17 UTSW 5 90260096 missense possibly damaging 0.93
R7051:Ankrd17 UTSW 5 90366451 unclassified probably benign
R7077:Ankrd17 UTSW 5 90285864 missense possibly damaging 0.92
R7134:Ankrd17 UTSW 5 90232314 missense probably damaging 0.99
R7134:Ankrd17 UTSW 5 90285523 missense probably benign 0.03
R7138:Ankrd17 UTSW 5 90242977 missense probably benign 0.38
R7173:Ankrd17 UTSW 5 90260117 missense possibly damaging 0.95
R7176:Ankrd17 UTSW 5 90268735 missense probably damaging 0.99
R7365:Ankrd17 UTSW 5 90291151 missense possibly damaging 0.45
R7390:Ankrd17 UTSW 5 90282920 missense probably benign 0.13
R7430:Ankrd17 UTSW 5 90295657 missense possibly damaging 0.80
R7468:Ankrd17 UTSW 5 90243043 missense probably benign
R7483:Ankrd17 UTSW 5 90299996 missense probably benign 0.00
R7492:Ankrd17 UTSW 5 90233948 missense possibly damaging 0.85
X0019:Ankrd17 UTSW 5 90298654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGAAGAAGTTTTCATGATGCT -3'
(R):5'- TTGCCTTTGGTATAACACAACCTTT -3'

Sequencing Primer
(F):5'- CATGATGCTGCCTTAAGTACTTGAG -3'
(R):5'- GTCCTCAGCCTGTAAAATGAGTCAG -3'
Posted On2019-05-15