Incidental Mutation 'R7143:Cyth3'
ID553533
Institutional Source Beutler Lab
Gene Symbol Cyth3
Ensembl Gene ENSMUSG00000018001
Gene Namecytohesin 3
SynonymsGrp1, Pscd3, cytohesin 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location143622447-143710250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143684396 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 12 (V12E)
Ref Sequence ENSEMBL: ENSMUSP00000112157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110727] [ENSMUST00000116456] [ENSMUST00000131436] [ENSMUST00000177196] [ENSMUST00000177281]
PDB Structure
GRP1 PH DOMAIN WITH INS(1,3,4,5)P4 [X-RAY DIFFRACTION]
GRP1 PH DOMAIN (UNLIGANDED) [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol(1,3,4,5,6)pentakisphosphate [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol 1,3,4,5-tetrakisphosphate [X-RAY DIFFRACTION]
Triglycine variant of the Grp1 Pleckstrin Homology Domain unliganded [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000110727
SMART Domains Protein: ENSMUSP00000106355
Gene: ENSMUSG00000018001

DomainStartEndE-ValueType
Sec7 15 200 1.5e-106 SMART
PH 217 334 1.1e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000116456
AA Change: V12E
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001
AA Change: V12E

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131436
SMART Domains Protein: ENSMUSP00000118290
Gene: ENSMUSG00000018001

DomainStartEndE-ValueType
Pfam:Sec7 13 70 5.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177196
Predicted Effect unknown
Transcript: ENSMUST00000177281
AA Change: V20E
SMART Domains Protein: ENSMUSP00000135287
Gene: ENSMUSG00000018001
AA Change: V20E

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Blast:Sec7 45 91 1e-11 BLAST
PDB:1S9D|E 63 93 4e-8 PDB
SCOP:d1pbv__ 65 93 7e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. PSCD family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This encoded protein is involved in the control of Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation factor protein 6 (ARF) functions, in addition to acting on ARF1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Cyth3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyth3 APN 5 143707165 splice site probably null
IGL01340:Cyth3 APN 5 143684435 nonsense probably null
IGL01372:Cyth3 APN 5 143692638 missense possibly damaging 0.93
IGL02092:Cyth3 APN 5 143707385 splice site probably benign
IGL02850:Cyth3 APN 5 143686504 missense probably damaging 0.97
IGL02892:Cyth3 APN 5 143707437 missense possibly damaging 0.86
R0373:Cyth3 UTSW 5 143684426 utr 5 prime probably benign
R0726:Cyth3 UTSW 5 143692642 missense probably benign 0.00
R1217:Cyth3 UTSW 5 143702820 missense probably damaging 1.00
R1552:Cyth3 UTSW 5 143697750 missense probably benign 0.12
R1623:Cyth3 UTSW 5 143701372 missense probably damaging 1.00
R1873:Cyth3 UTSW 5 143697761 missense possibly damaging 0.54
R3788:Cyth3 UTSW 5 143636543 intron probably benign
R4736:Cyth3 UTSW 5 143684479 critical splice donor site probably null
R6500:Cyth3 UTSW 5 143707840 missense probably damaging 0.97
R6824:Cyth3 UTSW 5 143686510 missense probably damaging 1.00
R7105:Cyth3 UTSW 5 143707272 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGAAGTACCCCACCATGGTG -3'
(R):5'- AGATTCAATGTCACGTGTTCCTG -3'

Sequencing Primer
(F):5'- TCAGGTCTCTGTGCTAAAGC -3'
(R):5'- AATGTCACGTGTTCCTGAAGCTAC -3'
Posted On2019-05-15