Mutagenetix > Incidental Mutations

Incidental Mutation 'R0601:Pkp1'

55355

Institutional Source

Beutler Lab

Gene Symbol

Pkp1

Ensembl Gene

ENSMUSG00000026413

Gene Name

plakophilin 1

Synonyms

MMRRC Submission

038790-MU

Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene?

Possibly essential (E-score: 0.601) question?

Stock #

R0601 (G1)

Quality Score

156

Status

Validated

Chromosome

Chromosomal Location

135871395-135919207 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135878182 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 593 (R593W)

Ref Sequence

ENSEMBL: ENSMUSP00000128418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]

AlphaFold

P97350

Predicted Effect

probably damaging
Transcript: ENSMUST00000027667
AA Change: R593W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: R593W

Domain	Start	End	E-Value	Type
low complexity region	52	60	N/A	INTRINSIC
ARM	277	317	2.65e-9	SMART
ARM	319	360	3.47e-4	SMART
ARM	361	416	1.3e1	SMART
ARM	417	464	5.59e1	SMART
ARM	516	557	8.48e1	SMART
ARM	565	604	3.85e0	SMART
ARM	605	650	5.76e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132793

Predicted Effect

probably damaging
Transcript: ENSMUST00000163260
AA Change: R593W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: R593W

Domain	Start	End	E-Value	Type
low complexity region	52	60	N/A	INTRINSIC
ARM	277	317	2.65e-9	SMART
ARM	319	360	3.47e-4	SMART
ARM	361	416	1.3e1	SMART
ARM	417	464	5.59e1	SMART
ARM	516	557	8.48e1	SMART
ARM	565	604	3.85e0	SMART
ARM	605	650	5.76e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189805

SMART Domains

Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

Domain	Start	End	E-Value	Type
low complexity region	52	60	N/A	INTRINSIC

Meta Mutation Damage Score

0.1489

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.2%

Validation Efficiency

98% (119/122)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 119 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930596D02Rik	T	G	14: 35,810,189	D143A	probably damaging	Het
Abca9	C	T	11: 110,117,058		probably null	Het
Abcc5	A	G	16: 20,404,559		probably benign	Het
Ablim3	T	A	18: 61,849,370	D168V	probably benign	Het
Acsl3	C	T	1: 78,696,179	S352F	probably damaging	Het
Adgrl4	A	T	3: 151,498,429		probably benign	Het
Arhgap29	A	G	3: 121,991,110	K229E	probably damaging	Het
Atad3a	A	T	4: 155,747,407	V470D	probably damaging	Het
Atp8b1	A	G	18: 64,571,653		probably null	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Bpifa5	A	G	2: 154,164,255	N121S	possibly damaging	Het
Bpifb4	G	A	2: 153,947,283		probably benign	Het
Bptf	T	A	11: 107,061,692	T2112S	probably benign	Het
Btnl4	T	C	17: 34,469,311	K498E	probably benign	Het
Calhm2	A	G	19: 47,141,030		probably null	Het
Capn3	A	T	2: 120,502,596		probably null	Het
Caps2	T	C	10: 112,195,790	F265L	possibly damaging	Het
Casp3	G	T	8: 46,636,227	C170F	probably benign	Het
Ccdc39	T	C	3: 33,819,839	R615G	probably damaging	Het
Cd177	A	G	7: 24,752,313	I426T	probably benign	Het
Cfap53	G	A	18: 74,300,150	R102H	possibly damaging	Het
Cfhr3	G	A	1: 139,593,885		noncoding transcript	Het
Col7a1	T	C	9: 108,980,584		probably benign	Het
Cplx3	T	C	9: 57,606,074	E24G	possibly damaging	Het
D11Wsu47e	T	A	11: 113,687,886	S36T	probably benign	Het
Dhx30	A	G	9: 110,086,714		probably null	Het
Dnah8	T	A	17: 30,708,358	N1329K	probably benign	Het
Dnajc11	C	G	4: 151,969,936	R200G	probably damaging	Het
Dok3	A	T	13: 55,524,263	F201I	probably benign	Het
Dpf2	A	T	19: 5,902,212	H303Q	probably damaging	Het
Dtnb	A	G	12: 3,735,039		probably benign	Het
Elk3	T	C	10: 93,265,481	E136G	probably damaging	Het
Ephb1	T	C	9: 102,195,130	D150G	probably damaging	Het
Erbb3	A	G	10: 128,577,012	S570P	probably benign	Het
F2	A	T	2: 91,633,311		probably null	Het
Fanca	A	T	8: 123,308,513	M231K	probably damaging	Het
Fbxo34	T	C	14: 47,530,257	V358A	probably benign	Het
Foxp1	C	T	6: 98,930,122	E666K	probably damaging	Het
Fto	A	G	8: 91,401,802		probably null	Het
Gbp2	C	T	3: 142,630,758	R290C	possibly damaging	Het
Grik2	T	G	10: 49,422,597	S343R	probably damaging	Het
Heatr5b	A	T	17: 78,768,545	M1448K	probably benign	Het
Hmgn3	A	T	9: 83,146,429		probably null	Het
Htt	T	C	5: 34,846,003	V1274A	probably benign	Het
Kcnh8	A	G	17: 52,894,005	D489G	probably damaging	Het
Kcnip3	A	T	2: 127,458,397		probably benign	Het
Kdm5a	A	G	6: 120,402,671	T647A	possibly damaging	Het
Krt72	T	C	15: 101,786,056	R135G	probably damaging	Het
Larp7	T	A	3: 127,544,209	K400N	probably damaging	Het
Lifr	T	C	15: 7,169,272		probably null	Het
Lima1	G	A	15: 99,780,472	P696L	probably damaging	Het
Lrrc8e	T	G	8: 4,235,239		probably null	Het
Map1a	A	G	2: 121,298,602	R116G	probably damaging	Het
Map3k13	A	G	16: 21,905,249	E327G	possibly damaging	Het
Med13	A	G	11: 86,345,962	V123A	possibly damaging	Het
Megf8	A	C	7: 25,328,540	H205P	probably benign	Het
Met	G	A	6: 17,555,632		probably null	Het
Mfsd14b	A	C	13: 65,087,150	V71G	possibly damaging	Het
Mpl	T	A	4: 118,443,536	T599S	probably benign	Het
Myh15	A	T	16: 49,061,581	D62V	probably damaging	Het
Myo5a	A	G	9: 75,174,015	T961A	probably benign	Het
Myrfl	A	G	10: 116,776,760	Y895H	probably damaging	Het
Nap1l1	T	C	10: 111,490,363		probably benign	Het
Ncapd3	T	A	9: 27,041,507	Y111N	probably benign	Het
Nlrc3	A	G	16: 3,948,249		probably benign	Het
Nsun2	G	T	13: 69,633,242	V657L	probably benign	Het
Olfr1026	A	T	2: 85,923,378	I37F	probably benign	Het
Olfr1247	T	A	2: 89,609,220	N294I	probably benign	Het
Olfr142	T	C	2: 90,252,934	D18G	probably benign	Het
Olfr1511	C	A	14: 52,389,826	G316*	probably null	Het
Olfr195	G	A	16: 59,149,754	M301I	probably benign	Het
Olfr596	T	C	7: 103,310,164	S148P	probably damaging	Het
Olfr646	A	T	7: 104,107,142	I288F	possibly damaging	Het
Olfr780	T	A	10: 129,322,016	M131K	possibly damaging	Het
Osbpl3	A	T	6: 50,299,403	V795D	probably benign	Het
Osbpl5	T	C	7: 143,709,549	D155G	probably damaging	Het
Parm1	G	A	5: 91,594,264	V164I	probably benign	Het
Pgd	A	T	4: 149,156,810		probably benign	Het
Polr2l	A	T	7: 141,473,342	V53E	probably damaging	Het
Ppp4c	G	T	7: 126,787,288	T29K	probably benign	Het
Ppp4r4	T	A	12: 103,600,520		probably benign	Het
Ptprd	A	G	4: 76,100,474	S688P	probably benign	Het
Rab3b	A	T	4: 108,890,389	I28F	probably damaging	Het
Rnase4	T	C	14: 51,105,095	L92P	probably benign	Het
Rnpc3	T	C	3: 113,620,106	E229G	probably benign	Het
Rtraf	A	T	14: 19,816,206	D147E	possibly damaging	Het
Rttn	G	A	18: 89,042,966	G1086D	probably benign	Het
Ryr2	A	G	13: 11,705,633		probably null	Het
Sft2d2	T	C	1: 165,183,861	I126V	probably benign	Het
Skap1	G	T	11: 96,723,410		probably benign	Het
Slc14a2	A	T	18: 78,157,179	L753*	probably null	Het
Slc25a5	G	A	X: 36,795,755	A9T	probably benign	Het
Slc30a5	T	C	13: 100,814,770		probably benign	Het
Slc5a4b	A	C	10: 76,064,036	I456S	possibly damaging	Het
Slc9a4	A	T	1: 40,603,070	S400C	probably damaging	Het
Slx1b	T	A	7: 126,692,640	H84L	probably damaging	Het
Sptbn1	T	C	11: 30,150,008	Y190C	probably damaging	Het
Stk32b	T	C	5: 37,531,566	Q138R	probably damaging	Het
Syt6	C	A	3: 103,620,890	D308E	probably damaging	Het
Sytl2	G	A	7: 90,395,166	D572N	probably damaging	Het
Taok2	A	T	7: 126,879,433	L109Q	probably damaging	Het
Tbl1xr1	T	C	3: 22,179,319		probably benign	Het
Tlk1	A	G	2: 70,714,158	I711T	probably benign	Het
Trf	A	G	9: 103,222,933		probably null	Het
Trpc2	A	G	7: 102,084,365	T548A	possibly damaging	Het
Ttbk2	A	T	2: 120,825,296	I29N	possibly damaging	Het
Tti1	A	T	2: 157,993,372	C989S	probably damaging	Het
Txndc8	A	G	4: 58,000,256	Y108H	probably benign	Het
Ugt2b1	A	T	5: 86,917,680	V500D	possibly damaging	Het
Vmn1r34	A	G	6: 66,637,664	I30T	possibly damaging	Het
Vmn2r115	A	G	17: 23,360,100	K849R	probably null	Het
Vmn2r76	T	A	7: 86,226,115		probably null	Het
Vps13c	T	A	9: 67,927,472	S1694R	probably benign	Het
Wdfy3	G	T	5: 101,836,172	P3509T	probably benign	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Wdr60	T	C	12: 116,255,935	D129G	possibly damaging	Het
Wnt8b	T	A	19: 44,493,667	W40R	probably benign	Het
Xrra1	A	G	7: 99,910,968	I384V	possibly damaging	Het
Zfp11	A	T	5: 129,657,907	H163Q	probably damaging	Het

Other mutations in Pkp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Pkp1	APN	1	135878184	missense	probably damaging	0.96
IGL02113:Pkp1	APN	1	135883914	missense	possibly damaging	0.92
IGL02149:Pkp1	APN	1	135886747	missense	probably benign	0.00
IGL02582:Pkp1	APN	1	135889926	missense	probably damaging	0.99
IGL02655:Pkp1	APN	1	135889773	missense	probably benign	0.14
IGL03166:Pkp1	APN	1	135878124	missense	probably damaging	1.00
P0008:Pkp1	UTSW	1	135875683	missense	probably benign	0.00
R0180:Pkp1	UTSW	1	135886800	missense	probably benign	0.00
R0368:Pkp1	UTSW	1	135875683	missense	probably benign
R0368:Pkp1	UTSW	1	135886852	missense	probably benign	0.00
R0725:Pkp1	UTSW	1	135880740	missense	probably benign	0.02
R1414:Pkp1	UTSW	1	135884085	splice site	probably benign
R1926:Pkp1	UTSW	1	135877673	missense	probably benign
R2082:Pkp1	UTSW	1	135884976	missense	possibly damaging	0.48
R2190:Pkp1	UTSW	1	135879971	missense	probably benign	0.02
R2249:Pkp1	UTSW	1	135880807	missense	probably damaging	1.00
R4457:Pkp1	UTSW	1	135875624	makesense	probably null
R4838:Pkp1	UTSW	1	135882588	missense	probably damaging	1.00
R4885:Pkp1	UTSW	1	135918952	missense	possibly damaging	0.92
R4995:Pkp1	UTSW	1	135880855	missense	possibly damaging	0.91
R5436:Pkp1	UTSW	1	135918918	missense	probably damaging	1.00
R5440:Pkp1	UTSW	1	135882492	missense	probably benign	0.41
R5652:Pkp1	UTSW	1	135882597	critical splice acceptor site	probably null
R5898:Pkp1	UTSW	1	135882521	missense	probably damaging	1.00
R5908:Pkp1	UTSW	1	135918883	nonsense	probably null
R6006:Pkp1	UTSW	1	135877668	splice site	probably null
R6013:Pkp1	UTSW	1	135883910	missense	probably damaging	1.00
R6218:Pkp1	UTSW	1	135879908	missense	probably damaging	0.96
R6232:Pkp1	UTSW	1	135886861	missense	probably benign	0.01
R7000:Pkp1	UTSW	1	135889954	missense	probably benign	0.41
R7799:Pkp1	UTSW	1	135889957	missense	possibly damaging	0.94
R7883:Pkp1	UTSW	1	135884903	critical splice donor site	probably null
R8486:Pkp1	UTSW	1	135918976	missense	probably damaging	1.00
R8822:Pkp1	UTSW	1	135879923	missense	probably benign	0.00
R8848:Pkp1	UTSW	1	135879914	missense	probably damaging	1.00
R9099:Pkp1	UTSW	1	135877691	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGAAGCAAGCAAGGTATCCCCTC -3'
(R):5'- AGCCTGACCCTTCATAGTCCCTTAG -3'

Sequencing Primer
(F):5'- GACTCCTCTATGAGGTGAGAATTCC -3'
(R):5'- gttggttggttggttTGGG -3'

Posted On

2013-07-11