Incidental Mutation 'R7143:Dnaic2'
ID553562
Institutional Source Beutler Lab
Gene Symbol Dnaic2
Ensembl Gene ENSMUSG00000034706
Gene Namedynein, axonemal, intermediate chain 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location114727408-114757889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114754250 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 504 (T504A)
Ref Sequence ENSEMBL: ENSMUSP00000065787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069325] [ENSMUST00000092469] [ENSMUST00000141762]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069325
AA Change: T504A

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065787
Gene: ENSMUSG00000034706
AA Change: T504A

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092469
AA Change: T504A

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090126
Gene: ENSMUSG00000034706
AA Change: T504A

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
WD40 441 480 4.93e1 SMART
low complexity region 519 545 N/A INTRINSIC
low complexity region 559 608 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141762
AA Change: T492A

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114700
Gene: ENSMUSG00000034706
AA Change: T492A

DomainStartEndE-ValueType
low complexity region 127 146 N/A INTRINSIC
WD40 206 245 2.86e0 SMART
WD40 248 293 3.33e-1 SMART
WD40 353 392 7.92e-3 SMART
WD40 396 436 2.05e1 SMART
low complexity region 458 476 N/A INTRINSIC
low complexity region 507 533 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dynein intermediate chain family, and is part of the dynein complex of respiratory cilia and sperm flagella. Mutations in this gene are associated with primary ciliary dyskinesia type 9. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Dnaic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Dnaic2 APN 11 114751788 missense probably benign 0.37
IGL01548:Dnaic2 APN 11 114752942 missense probably damaging 1.00
IGL02719:Dnaic2 APN 11 114751911 missense probably damaging 1.00
IGL03236:Dnaic2 APN 11 114757249 unclassified probably benign
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0096:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R0305:Dnaic2 UTSW 11 114752894 missense probably benign 0.09
R0472:Dnaic2 UTSW 11 114745189 splice site probably benign
R0711:Dnaic2 UTSW 11 114754332 missense probably benign 0.04
R1756:Dnaic2 UTSW 11 114750380 missense probably benign 0.02
R1861:Dnaic2 UTSW 11 114752951 missense possibly damaging 0.56
R1916:Dnaic2 UTSW 11 114732923 missense possibly damaging 0.88
R1981:Dnaic2 UTSW 11 114732929 missense probably damaging 1.00
R1983:Dnaic2 UTSW 11 114735856 splice site probably null
R2430:Dnaic2 UTSW 11 114757186 unclassified probably benign
R2510:Dnaic2 UTSW 11 114757167 unclassified probably benign
R3001:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3002:Dnaic2 UTSW 11 114750471 missense probably damaging 1.00
R3113:Dnaic2 UTSW 11 114751930 splice site probably null
R3803:Dnaic2 UTSW 11 114738725 missense probably benign
R3874:Dnaic2 UTSW 11 114732955 missense probably damaging 1.00
R4853:Dnaic2 UTSW 11 114745091 missense probably benign 0.03
R5267:Dnaic2 UTSW 11 114740467 missense probably benign 0.02
R6008:Dnaic2 UTSW 11 114752990 missense probably benign 0.01
R6024:Dnaic2 UTSW 11 114752908 missense possibly damaging 0.85
R6819:Dnaic2 UTSW 11 114745091 missense probably benign 0.00
R7053:Dnaic2 UTSW 11 114738695 missense probably damaging 1.00
R7208:Dnaic2 UTSW 11 114757162 missense unknown
R7275:Dnaic2 UTSW 11 114757228 missense unknown
R7463:Dnaic2 UTSW 11 114754406 missense probably benign 0.07
R7779:Dnaic2 UTSW 11 114754409 missense possibly damaging 0.50
RF012:Dnaic2 UTSW 11 114750416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATGAATCTCTCATCTCTGGC -3'
(R):5'- TGCTTACAGGCTTCGGTTTC -3'

Sequencing Primer
(F):5'- GGCATAGATTCTCCTGCACAG -3'
(R):5'- ACAGGCTTCGGTTTCTTCTTCAAG -3'
Posted On2019-05-15