Mutagenetix > Incidental Mutation

Incidental Mutation 'R7143:Heatr5a'

553564

Institutional Source

Beutler Lab

Gene Symbol

Heatr5a

Ensembl Gene

ENSMUSG00000035181

Gene Name

HEAT repeat containing 5A

Synonyms

D930036F22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R7143 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

51875871-51971321 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 51961468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 31 (R31G)

Ref Sequence

ENSEMBL: ENSMUSP00000043115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040583]

AlphaFold

Q5PRF0

Predicted Effect

probably benign
Transcript: ENSMUST00000040583
AA Change: R31G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: R31G

Domain	Start	End	E-Value	Type
low complexity region	56	67	N/A	INTRINSIC
SCOP:d1qbkb_	112	658	6e-13	SMART
low complexity region	1063	1078	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1110	1120	N/A	INTRINSIC
low complexity region	1122	1135	N/A	INTRINSIC
low complexity region	1496	1507	N/A	INTRINSIC
low complexity region	1722	1735	N/A	INTRINSIC
low complexity region	1925	1936	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930516K23Rik	C	T	7: 104,059,215	C129Y	probably damaging	Het
Agbl4	A	G	4: 111,617,136	N374S	probably damaging	Het
Agl	A	G	3: 116,792,021	S153P	probably damaging	Het
Akap6	T	G	12: 52,887,364	D546E	probably benign	Het
Ankrd17	C	A	5: 90,285,961	A650S	possibly damaging	Het
Ankrd53	A	G	6: 83,762,911	R16G	possibly damaging	Het
Apba2	T	C	7: 64,744,417	L570P	probably damaging	Het
Asap1	A	G	15: 64,191,528	F101L	probably damaging	Het
Cadm4	T	A	7: 24,499,567	I89N	possibly damaging	Het
Cadps	C	T	14: 12,491,838	V771I	probably benign	Het
Cenph	A	G	13: 100,761,777	V206A	possibly damaging	Het
Cenpn	A	G	8: 116,937,227	T253A	probably benign	Het
Cep120	C	T	18: 53,683,385	G939R	probably benign	Het
Cfap57	G	A	4: 118,620,709		probably benign	Het
Clip1	T	C	5: 123,653,610	I166V	probably benign	Het
Cstf3	T	A	2: 104,646,616	V144E	probably benign	Het
Cyp21a1	T	A	17: 34,802,326	H357L	probably damaging	Het
Cyth3	T	A	5: 143,684,396	V12E	unknown	Het
Dgat2	T	C	7: 99,157,124	I289V	probably benign	Het
Dip2a	A	G	10: 76,297,791	C527R	probably damaging	Het
Dnah17	A	C	11: 118,086,130	W1879G	probably damaging	Het
Dnaic2	A	G	11: 114,754,250	T504A	possibly damaging	Het
Efl1	C	T	7: 82,762,680	P759L	probably damaging	Het
Egfr	A	C	11: 16,871,627	I351L	probably benign	Het
Ercc6	G	A	14: 32,570,305	E1209K	probably damaging	Het
Fam135b	A	T	15: 71,479,151	M292K	probably benign	Het
Fbxl7	C	A	15: 26,543,158	V468L	probably benign	Het
Fhl2	G	T	1: 43,141,851	H60N	probably damaging	Het
G6pc	G	T	11: 101,370,723	R83L	probably damaging	Het
Gata4	C	A	14: 63,204,617	R252L	probably damaging	Het
Glt8d1	T	A	14: 31,006,645	I10N	probably damaging	Het
Gm10471	T	A	5: 26,085,676	I166F	probably benign	Het
Gm10803	T	A	2: 93,563,959	Y25*	probably null	Het
Gm19345	T	C	7: 19,857,834	F108S	unknown	Het
Gm4952	A	G	19: 12,618,407	T54A	possibly damaging	Het
Gprc6a	C	T	10: 51,614,890	R921H	probably benign	Het
Hc	A	T	2: 35,050,438	H129Q	probably benign	Het
Hephl1	T	C	9: 15,060,810	K945E	possibly damaging	Het
Ik	G	T	18: 36,751,177	M237I	probably damaging	Het
Izumo1	T	A	7: 45,627,095	S361T	probably benign	Het
Kcnq4	A	G	4: 120,711,239	F427L	probably benign	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Kifap3	T	A	1: 163,856,040	M430K	possibly damaging	Het
Lamb3	A	G	1: 193,304,565	E53G	probably damaging	Het
Lrp1b	A	T	2: 41,312,643	I1266K		Het
Nat8	A	T	6: 85,830,503	I216K	probably benign	Het
Ncapd2	T	C	6: 125,179,561	I454V	probably benign	Het
Nlrp4f	A	T	13: 65,195,306	V153E	probably damaging	Het
Nlrp4f	G	C	13: 65,199,352	Q9E	possibly damaging	Het
Npy2r	A	T	3: 82,540,943	I175N	probably benign	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1247	T	C	2: 89,610,019	M28V	probably benign	Het
Olfr364-ps1	A	G	2: 37,146,874	T221A	probably benign	Het
Olfr665	C	T	7: 104,881,186	P160S	probably damaging	Het
Pcdh9	T	C	14: 93,888,272	N154S	probably damaging	Het
Pcdhb2	A	T	18: 37,295,881	E302D	probably benign	Het
Pclo	T	A	5: 14,858,822	V5048E	unknown	Het
Pcnt	A	G	10: 76,389,060	L1870S	possibly damaging	Het
Pigc	T	C	1: 161,970,592	Y48H	probably damaging	Het
Pisd	C	T	5: 32,738,502	V241I	possibly damaging	Het
Pkhd1l1	A	T	15: 44,573,637	M3464L	possibly damaging	Het
Pofut2	T	A	10: 77,259,426	I35N	probably benign	Het
Prss27	A	G	17: 24,045,658	Y265C	probably damaging	Het
Prss56	T	A	1: 87,188,153	I583K	probably benign	Het
Rnpep	T	C	1: 135,283,749	E87G	probably benign	Het
Shtn1	T	C	19: 59,018,906	H304R	probably damaging	Het
Slc23a4	A	T	6: 34,978,913	I62N	probably damaging	Het
Slc35e2	A	T	4: 155,618,594	I355F	probably benign	Het
Snx25	T	C	8: 46,035,715	I868V	possibly damaging	Het
Spatc1l	T	A	10: 76,569,931	L323Q	probably damaging	Het
Taok1	A	G	11: 77,537,988	V962A	probably benign	Het
Tas2r140	A	G	6: 133,055,519	I92T	probably benign	Het
Trim17	C	A	11: 58,965,184	Y22*	probably null	Het
Tti1	T	A	2: 158,007,676	M548L	probably benign	Het
Unc93b1	T	C	19: 3,935,204	V4A	unknown	Het
Utp3	G	C	5: 88,554,517		probably benign	Het
Vmn1r225	A	T	17: 20,502,384	Y29F	probably benign	Het
Vmn1r34	A	T	6: 66,637,664	I30N	probably benign	Het
Vmn2r67	T	A	7: 85,152,638	M152L	probably benign	Het
Wdr20rt	T	G	12: 65,225,918	F52V	probably benign	Het
Zfp869	G	T	8: 69,706,656	H422Q	probably damaging	Het

Other mutations in Heatr5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Heatr5a	APN	12	51888901	missense	probably damaging	0.99
IGL01397:Heatr5a	APN	12	51894369	missense	possibly damaging	0.89
IGL01481:Heatr5a	APN	12	51955425	missense	probably damaging	1.00
IGL01684:Heatr5a	APN	12	51955511	missense	probably benign	0.36
IGL01766:Heatr5a	APN	12	51889664	missense	probably benign	0.15
IGL01799:Heatr5a	APN	12	51897835	missense	probably benign	0.17
IGL02007:Heatr5a	APN	12	51916158	missense	probably damaging	1.00
IGL02093:Heatr5a	APN	12	51916075	missense	possibly damaging	0.68
IGL02205:Heatr5a	APN	12	51877337	missense	probably damaging	1.00
IGL02450:Heatr5a	APN	12	51945430	missense	probably benign	0.02
IGL02565:Heatr5a	APN	12	51951099	missense	possibly damaging	0.54
IGL02707:Heatr5a	APN	12	51921366	missense	probably benign	0.01
IGL02735:Heatr5a	APN	12	51915021	missense	probably damaging	0.99
IGL03160:Heatr5a	APN	12	51884496	splice site	probably benign
F5770:Heatr5a	UTSW	12	51881278	splice site	probably benign
R0034:Heatr5a	UTSW	12	51925172	missense	probably damaging	1.00
R0127:Heatr5a	UTSW	12	51925405	missense	probably benign
R0184:Heatr5a	UTSW	12	51909969	missense	probably benign	0.00
R0362:Heatr5a	UTSW	12	51888861	missense	probably damaging	1.00
R0567:Heatr5a	UTSW	12	51910089	missense	probably damaging	1.00
R0591:Heatr5a	UTSW	12	51910101	splice site	probably benign
R0736:Heatr5a	UTSW	12	51896561	critical splice donor site	probably null
R1532:Heatr5a	UTSW	12	51952518	missense	probably damaging	0.99
R1914:Heatr5a	UTSW	12	51905467	missense	probably damaging	1.00
R1956:Heatr5a	UTSW	12	51945419	critical splice donor site	probably null
R1978:Heatr5a	UTSW	12	51939658	missense	possibly damaging	0.77
R2044:Heatr5a	UTSW	12	51955403	missense	probably benign	0.19
R2263:Heatr5a	UTSW	12	51916150	missense	probably damaging	0.97
R2265:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2267:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2268:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2269:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2842:Heatr5a	UTSW	12	51955478	missense	probably null	1.00
R2842:Heatr5a	UTSW	12	51955477	splice site	probably null
R3033:Heatr5a	UTSW	12	51951038	nonsense	probably null
R4303:Heatr5a	UTSW	12	51956225	missense	probably benign	0.01
R4675:Heatr5a	UTSW	12	51877347	missense	probably benign	0.17
R4718:Heatr5a	UTSW	12	51916163	missense	possibly damaging	0.95
R4807:Heatr5a	UTSW	12	51877520	missense	probably damaging	1.00
R5114:Heatr5a	UTSW	12	51956237	nonsense	probably null
R5229:Heatr5a	UTSW	12	51947978	missense	probably benign	0.33
R5411:Heatr5a	UTSW	12	51888243	missense	probably damaging	1.00
R5548:Heatr5a	UTSW	12	51958951	nonsense	probably null
R5603:Heatr5a	UTSW	12	51877575	missense	probably benign	0.26
R5631:Heatr5a	UTSW	12	51955527	missense	probably benign	0.22
R5742:Heatr5a	UTSW	12	51955552	nonsense	probably null
R5969:Heatr5a	UTSW	12	51959040	missense	probably benign
R6020:Heatr5a	UTSW	12	51884327	missense	probably benign	0.01
R6234:Heatr5a	UTSW	12	51877454	missense	possibly damaging	0.69
R6352:Heatr5a	UTSW	12	51951166	missense	possibly damaging	0.88
R6798:Heatr5a	UTSW	12	51881265	missense	probably benign	0.01
R6815:Heatr5a	UTSW	12	51955508	missense	possibly damaging	0.89
R7059:Heatr5a	UTSW	12	51888234	missense	probably damaging	0.98
R7178:Heatr5a	UTSW	12	51925142	missense	probably damaging	0.99
R7291:Heatr5a	UTSW	12	51925339	missense	probably damaging	0.97
R7454:Heatr5a	UTSW	12	51961543	missense	probably benign	0.20
R7511:Heatr5a	UTSW	12	51879434	missense	possibly damaging	0.94
R7636:Heatr5a	UTSW	12	51888196	missense	probably damaging	1.00
R7636:Heatr5a	UTSW	12	51952558	missense	probably damaging	1.00
R7665:Heatr5a	UTSW	12	51961530	missense	probably damaging	1.00
R8088:Heatr5a	UTSW	12	51947996	missense	possibly damaging	0.85
R8205:Heatr5a	UTSW	12	51959009	missense	probably benign	0.05
R8212:Heatr5a	UTSW	12	51899229	missense	probably benign	0.00
R8213:Heatr5a	UTSW	12	51891443	missense	probably damaging	0.96
R8323:Heatr5a	UTSW	12	51955506	missense	probably benign	0.02
R8326:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8339:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8395:Heatr5a	UTSW	12	51916178	missense
R8410:Heatr5a	UTSW	12	51938120	missense	probably benign	0.01
R8676:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8834:Heatr5a	UTSW	12	51909956	critical splice donor site	probably null
R8916:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R9057:Heatr5a	UTSW	12	51939637	missense	probably damaging	1.00
R9248:Heatr5a	UTSW	12	51916243	missense
R9287:Heatr5a	UTSW	12	51920477	missense	probably damaging	0.97
R9332:Heatr5a	UTSW	12	51899285	missense	probably benign	0.33
R9454:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R9515:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R9654:Heatr5a	UTSW	12	51958995	missense	probably damaging	1.00
V7732:Heatr5a	UTSW	12	51905324	missense	possibly damaging	0.65
Z1088:Heatr5a	UTSW	12	51891404	missense	probably damaging	1.00
Z1088:Heatr5a	UTSW	12	51951076	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- CTTCAGAAGGGACAAGGAATCC -3'
(R):5'- GTGTTGTTTCTCCACCGCAG -3'

Sequencing Primer
(F):5'- GGGACAAGGAATCCACCATATTTC -3'
(R):5'- GCAGGCTCGGTTCCTTAG -3'

Posted On

2019-05-15