Incidental Mutation 'R7143:Cyp21a1'
ID553581
Institutional Source Beutler Lab
Gene Symbol Cyp21a1
Ensembl Gene ENSMUSG00000024365
Gene Namecytochrome P450, family 21, subfamily a, polypeptide 1
SynonymsOh21-1, 21OHA, 21-hydroxylase, 21-OH, Cyp21, 21OH, Oh21-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34801348-34804561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34802326 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 357 (H357L)
Ref Sequence ENSEMBL: ENSMUSP00000025223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025223]
Predicted Effect probably damaging
Transcript: ENSMUST00000025223
AA Change: H357L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025223
Gene: ENSMUSG00000024365
AA Change: H357L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:p450 29 473 3.9e-98 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates steroids at the 21 position. Its activity is required for the synthesis of steroid hormones including cortisol and aldosterone. Mutations in this gene cause congenital adrenal hyperplasia. A related pseudogene is located near this gene; gene conversion events involving the functional gene and the pseudogene are thought to account for many cases of steroid 21-hydroxylase deficiency. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: An 80kb deletion including Cyp21a1 is found in mice with the H2 haplotype aw18. Homozygotes are lethal, but can be rescued with a Cyp21a1 transgene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Cyp21a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cyp21a1 APN 17 34804134 critical splice acceptor site probably null
IGL01688:Cyp21a1 APN 17 34802220 missense probably damaging 1.00
IGL02352:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02359:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02418:Cyp21a1 APN 17 34804188 splice site probably benign
IGL03089:Cyp21a1 APN 17 34803446 splice site probably null
R0480:Cyp21a1 UTSW 17 34801826 missense probably damaging 1.00
R1386:Cyp21a1 UTSW 17 34802210 missense probably damaging 0.98
R1831:Cyp21a1 UTSW 17 34804035 splice site probably benign
R2159:Cyp21a1 UTSW 17 34802404 missense probably benign 0.21
R2209:Cyp21a1 UTSW 17 34802727 nonsense probably null
R4968:Cyp21a1 UTSW 17 34803409 missense possibly damaging 0.93
R5957:Cyp21a1 UTSW 17 34803176 missense probably benign 0.13
R6374:Cyp21a1 UTSW 17 34804136 splice site probably null
R7077:Cyp21a1 UTSW 17 34802359 missense probably damaging 1.00
R7798:Cyp21a1 UTSW 17 34804321 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAGTTTGTCCCAGCAGAGG -3'
(R):5'- AAGTCTGGTCCCTAGAGCTC -3'

Sequencing Primer
(F):5'- ATACCTGGCCAGAACTTGCTG -3'
(R):5'- GTCCCTAGAGCTCAGCCTTG -3'
Posted On2019-05-15