Incidental Mutation 'R7143:Ik'
ID553582
Institutional Source Beutler Lab
Gene Symbol Ik
Ensembl Gene ENSMUSG00000024474
Gene NameIK cytokine
SynonymsMuRED
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36744656-36757639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36751177 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 237 (M237I)
Ref Sequence ENSEMBL: ENSMUSP00000007042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007042]
Predicted Effect probably damaging
Transcript: ENSMUST00000007042
AA Change: M237I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474
AA Change: M237I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its RED repeat, a stretch of repeated arginine, glutamic acid and aspartic acid residues. The protein localizes to discrete dots within the nucleus, excluding the nucleolus. Its function is unknown. This gene maps to chromosome 5; however, a pseudogene may exist on chromosome 2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pcdhb2 A T 18: 37,295,881 E302D probably benign Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Ik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Ik APN 18 36756868 nonsense probably null
IGL01409:Ik APN 18 36756921 missense probably damaging 1.00
IGL01636:Ik APN 18 36751201 missense possibly damaging 0.63
IGL02282:Ik APN 18 36745644 missense probably damaging 0.99
IGL02422:Ik APN 18 36753260 critical splice acceptor site probably null
IGL03263:Ik APN 18 36748646 missense probably damaging 0.98
IGL03356:Ik APN 18 36756604 missense probably damaging 1.00
R0675:Ik UTSW 18 36747333 unclassified probably benign
R1778:Ik UTSW 18 36756818 unclassified probably benign
R4060:Ik UTSW 18 36748890 missense probably damaging 0.96
R4606:Ik UTSW 18 36753555 missense possibly damaging 0.68
R4684:Ik UTSW 18 36752414 missense probably damaging 1.00
R4819:Ik UTSW 18 36753257 splice site probably null
R4978:Ik UTSW 18 36747415 missense possibly damaging 0.54
R5256:Ik UTSW 18 36748873 missense probably benign 0.00
R5751:Ik UTSW 18 36753513 missense probably benign 0.07
R5966:Ik UTSW 18 36755478 missense possibly damaging 0.50
R6378:Ik UTSW 18 36757288 missense probably damaging 1.00
R6952:Ik UTSW 18 36753560 missense probably damaging 1.00
R7068:Ik UTSW 18 36755465 missense possibly damaging 0.57
R7242:Ik UTSW 18 36748222 missense probably null 1.00
Z1088:Ik UTSW 18 36744782 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGTGGTAGAGCAGCTGATG -3'
(R):5'- GCATTCAACTGAGACTGAGGGG -3'

Sequencing Primer
(F):5'- CTGATGCTTAGCACAGAGTAGGTG -3'
(R):5'- GGCTCTCAGAACTTGGTT -3'
Posted On2019-05-15