Incidental Mutation 'R7143:Pcdhb2'
ID553583
Institutional Source Beutler Lab
Gene Symbol Pcdhb2
Ensembl Gene ENSMUSG00000051599
Gene Nameprotocadherin beta 2
SynonymsPcdhbB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7143 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37294812-37297624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37295881 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 302 (E302D)
Ref Sequence ENSEMBL: ENSMUSP00000057921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056522] [ENSMUST00000115661] [ENSMUST00000193137] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056522
AA Change: E302D

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000057921
Gene: ENSMUSG00000051599
AA Change: E302D

DomainStartEndE-ValueType
Pfam:Cadherin_2 32 114 5.2e-33 PFAM
CA 157 242 1.74e-19 SMART
CA 266 347 5.99e-23 SMART
CA 370 451 1.16e-20 SMART
CA 475 561 5.94e-27 SMART
CA 591 672 2.03e-11 SMART
Pfam:Cadherin_C_2 688 771 3.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193137
SMART Domains Protein: ENSMUSP00000141439
Gene: ENSMUSG00000051599

DomainStartEndE-ValueType
CA 13 94 1.8e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik C T 7: 104,059,215 C129Y probably damaging Het
Agbl4 A G 4: 111,617,136 N374S probably damaging Het
Agl A G 3: 116,792,021 S153P probably damaging Het
Akap6 T G 12: 52,887,364 D546E probably benign Het
Ankrd17 C A 5: 90,285,961 A650S possibly damaging Het
Ankrd53 A G 6: 83,762,911 R16G possibly damaging Het
Apba2 T C 7: 64,744,417 L570P probably damaging Het
Asap1 A G 15: 64,191,528 F101L probably damaging Het
Cadm4 T A 7: 24,499,567 I89N possibly damaging Het
Cadps C T 14: 12,491,838 V771I probably benign Het
Cenph A G 13: 100,761,777 V206A possibly damaging Het
Cenpn A G 8: 116,937,227 T253A probably benign Het
Cep120 C T 18: 53,683,385 G939R probably benign Het
Cfap57 G A 4: 118,620,709 probably benign Het
Clip1 T C 5: 123,653,610 I166V probably benign Het
Cstf3 T A 2: 104,646,616 V144E probably benign Het
Cyp21a1 T A 17: 34,802,326 H357L probably damaging Het
Cyth3 T A 5: 143,684,396 V12E unknown Het
Dgat2 T C 7: 99,157,124 I289V probably benign Het
Dip2a A G 10: 76,297,791 C527R probably damaging Het
Dnah17 A C 11: 118,086,130 W1879G probably damaging Het
Dnaic2 A G 11: 114,754,250 T504A possibly damaging Het
Efl1 C T 7: 82,762,680 P759L probably damaging Het
Egfr A C 11: 16,871,627 I351L probably benign Het
Ercc6 G A 14: 32,570,305 E1209K probably damaging Het
Fam135b A T 15: 71,479,151 M292K probably benign Het
Fbxl7 C A 15: 26,543,158 V468L probably benign Het
Fhl2 G T 1: 43,141,851 H60N probably damaging Het
G6pc G T 11: 101,370,723 R83L probably damaging Het
Gata4 C A 14: 63,204,617 R252L probably damaging Het
Glt8d1 T A 14: 31,006,645 I10N probably damaging Het
Gm10471 T A 5: 26,085,676 I166F probably benign Het
Gm10803 T A 2: 93,563,959 Y25* probably null Het
Gm19345 T C 7: 19,857,834 F108S unknown Het
Gm4952 A G 19: 12,618,407 T54A possibly damaging Het
Gprc6a C T 10: 51,614,890 R921H probably benign Het
Hc A T 2: 35,050,438 H129Q probably benign Het
Heatr5a T C 12: 51,961,468 R31G probably benign Het
Hephl1 T C 9: 15,060,810 K945E possibly damaging Het
Ik G T 18: 36,751,177 M237I probably damaging Het
Izumo1 T A 7: 45,627,095 S361T probably benign Het
Kcnq4 A G 4: 120,711,239 F427L probably benign Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Kifap3 T A 1: 163,856,040 M430K possibly damaging Het
Lamb3 A G 1: 193,304,565 E53G probably damaging Het
Lrp1b A T 2: 41,312,643 I1266K Het
Nat8 A T 6: 85,830,503 I216K probably benign Het
Ncapd2 T C 6: 125,179,561 I454V probably benign Het
Nlrp4f A T 13: 65,195,306 V153E probably damaging Het
Nlrp4f G C 13: 65,199,352 Q9E possibly damaging Het
Npy2r A T 3: 82,540,943 I175N probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1247 T C 2: 89,610,019 M28V probably benign Het
Olfr364-ps1 A G 2: 37,146,874 T221A probably benign Het
Olfr665 C T 7: 104,881,186 P160S probably damaging Het
Pcdh9 T C 14: 93,888,272 N154S probably damaging Het
Pclo T A 5: 14,858,822 V5048E unknown Het
Pcnt A G 10: 76,389,060 L1870S possibly damaging Het
Pigc T C 1: 161,970,592 Y48H probably damaging Het
Pisd C T 5: 32,738,502 V241I possibly damaging Het
Pkhd1l1 A T 15: 44,573,637 M3464L possibly damaging Het
Pofut2 T A 10: 77,259,426 I35N probably benign Het
Prss27 A G 17: 24,045,658 Y265C probably damaging Het
Prss56 T A 1: 87,188,153 I583K probably benign Het
Rnpep T C 1: 135,283,749 E87G probably benign Het
Shtn1 T C 19: 59,018,906 H304R probably damaging Het
Slc23a4 A T 6: 34,978,913 I62N probably damaging Het
Slc35e2 A T 4: 155,618,594 I355F probably benign Het
Snx25 T C 8: 46,035,715 I868V possibly damaging Het
Spatc1l T A 10: 76,569,931 L323Q probably damaging Het
Taok1 A G 11: 77,537,988 V962A probably benign Het
Tas2r140 A G 6: 133,055,519 I92T probably benign Het
Trim17 C A 11: 58,965,184 Y22* probably null Het
Tti1 T A 2: 158,007,676 M548L probably benign Het
Unc93b1 T C 19: 3,935,204 V4A unknown Het
Utp3 G C 5: 88,554,517 probably benign Het
Vmn1r225 A T 17: 20,502,384 Y29F probably benign Het
Vmn1r34 A T 6: 66,637,664 I30N probably benign Het
Vmn2r67 T A 7: 85,152,638 M152L probably benign Het
Wdr20rt T G 12: 65,225,918 F52V probably benign Het
Zfp869 G T 8: 69,706,656 H422Q probably damaging Het
Other mutations in Pcdhb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Pcdhb2 APN 18 37296463 unclassified probably null
IGL01538:Pcdhb2 APN 18 37295322 nonsense probably null
IGL01716:Pcdhb2 APN 18 37296738 missense probably damaging 0.99
IGL01747:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01770:Pcdhb2 APN 18 37296303 missense probably damaging 1.00
IGL01999:Pcdhb2 APN 18 37296837 missense probably damaging 1.00
IGL02174:Pcdhb2 APN 18 37296498 missense probably damaging 1.00
IGL02325:Pcdhb2 APN 18 37296680 missense possibly damaging 0.91
IGL03148:Pcdhb2 APN 18 37296778 missense probably damaging 1.00
IGL03263:Pcdhb2 APN 18 37296006 missense probably damaging 1.00
R0158:Pcdhb2 UTSW 18 37297230 missense probably damaging 1.00
R0512:Pcdhb2 UTSW 18 37295979 missense probably damaging 1.00
R0656:Pcdhb2 UTSW 18 37295490 missense probably damaging 1.00
R0670:Pcdhb2 UTSW 18 37296648 missense probably damaging 1.00
R0698:Pcdhb2 UTSW 18 37297366 missense probably benign 0.00
R0825:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0827:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0862:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R0863:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1344:Pcdhb2 UTSW 18 37295657 missense possibly damaging 0.61
R1440:Pcdhb2 UTSW 18 37296290 missense probably benign 0.22
R1826:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1828:Pcdhb2 UTSW 18 37295985 missense probably damaging 0.99
R1869:Pcdhb2 UTSW 18 37297355 unclassified probably null
R1871:Pcdhb2 UTSW 18 37297355 unclassified probably null
R2292:Pcdhb2 UTSW 18 37297244 unclassified probably null
R3743:Pcdhb2 UTSW 18 37296417 missense probably damaging 1.00
R4067:Pcdhb2 UTSW 18 37297314 unclassified probably null
R4127:Pcdhb2 UTSW 18 37295541 missense probably damaging 0.97
R4402:Pcdhb2 UTSW 18 37295402 missense probably benign 0.05
R4579:Pcdhb2 UTSW 18 37296115 missense probably damaging 1.00
R4621:Pcdhb2 UTSW 18 37295927 missense probably benign 0.44
R4678:Pcdhb2 UTSW 18 37296207 missense probably damaging 1.00
R5143:Pcdhb2 UTSW 18 37296732 missense probably damaging 1.00
R5152:Pcdhb2 UTSW 18 37296126 missense probably damaging 0.97
R6552:Pcdhb2 UTSW 18 37295993 missense probably benign
R6908:Pcdhb2 UTSW 18 37296524 missense probably damaging 1.00
R6973:Pcdhb2 UTSW 18 37296363 missense probably benign 0.03
R7248:Pcdhb2 UTSW 18 37296494 missense probably damaging 1.00
R7586:Pcdhb2 UTSW 18 37295804 nonsense probably null
R7634:Pcdhb2 UTSW 18 37294947 intron probably benign
R7796:Pcdhb2 UTSW 18 37295393 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGCTTCGCTATGAGGTTCAGATC -3'
(R):5'- TGTCTCCAGAGTCAGAATCTGC -3'

Sequencing Primer
(F):5'- CGCTATGAGGTTCAGATCCCAGAG -3'
(R):5'- TAAACACAGCAATTACGGTTTCC -3'
Posted On2019-05-15