Incidental Mutation 'R7144:St18'
ID 553588
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Name suppression of tumorigenicity 18
Synonyms Nzf3, Myt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7144 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 6487231-6860940 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 6833594 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 693 (E693A)
Ref Sequence ENSEMBL: ENSMUSP00000042056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
AlphaFold Q80TY4
Predicted Effect probably damaging
Transcript: ENSMUST00000043578
AA Change: E693A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: E693A

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131494
AA Change: E693A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: E693A

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140079
AA Change: E693A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: E693A

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150761
AA Change: E693A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: E693A

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151281
AA Change: E693A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: E693A

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163727
AA Change: E693A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: E693A

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,433,573 I272F possibly damaging Het
Adcy10 G T 1: 165,510,370 M184I probably benign Het
Aldoa G T 7: 126,796,862 T124N possibly damaging Het
Ap4e1 T A 2: 127,011,807 I55N probably damaging Het
Arhgap21 T C 2: 20,865,387 T913A probably benign Het
Atrnl1 G A 19: 58,042,352 E1309K probably damaging Het
BC034090 A T 1: 155,242,031 C114S probably damaging Het
Brinp2 A G 1: 158,295,424 probably null Het
Ccna1 G T 3: 55,045,699 H408Q probably benign Het
Cd209g T G 8: 4,135,189 probably benign Het
Cdc20b A G 13: 113,083,371 I433V probably benign Het
Cdk2ap1 G A 5: 124,354,358 P5L probably damaging Het
Cep128 T C 12: 91,294,159 E310G probably damaging Het
Cflar G T 1: 58,753,848 V458F Het
Clec4b2 A G 6: 123,181,384 T70A probably benign Het
Cntnap5c A G 17: 58,286,888 T741A probably benign Het
Csf3r A T 4: 126,043,722 T800S probably benign Het
Csnk1g2 T C 10: 80,637,899 Y67H probably damaging Het
Cyp2c67 A T 19: 39,615,694 V406E probably benign Het
Dnah10 A G 5: 124,822,942 D3868G probably damaging Het
Dnah7a A T 1: 53,698,708 probably null Het
Dst A G 1: 34,152,243 N208S probably damaging Het
Echdc3 A G 2: 6,206,413 probably null Het
Edrf1 T C 7: 133,637,849 S13P probably benign Het
Ephb1 T C 9: 101,964,077 Y734C probably damaging Het
Eps8l1 A G 7: 4,472,185 Y325C probably damaging Het
Evc2 A G 5: 37,386,839 D644G probably damaging Het
Eya4 A C 10: 23,173,045 D54E probably benign Het
Filip1 T C 9: 79,820,213 S375G possibly damaging Het
Fmo9 A G 1: 166,677,620 M68T probably benign Het
Gemin5 G C 11: 58,141,663 P772A probably benign Het
Gle1 T G 2: 29,943,793 C401G probably damaging Het
Gm14548 A G 7: 3,897,616 V45A probably damaging Het
Gm7298 A T 6: 121,761,587 I376F probably damaging Het
Gpr35 A C 1: 92,982,631 I22L probably benign Het
Grin2b T G 6: 135,733,476 D1024A possibly damaging Het
Hmcn1 T C 1: 150,663,873 N2956D probably damaging Het
Htt T C 5: 34,846,006 L1275P probably damaging Het
Ibtk T C 9: 85,743,691 D2G probably benign Het
Il16 T A 7: 83,646,451 D1170V probably damaging Het
Iqgap3 T A 3: 88,116,910 I1513N probably damaging Het
Kiz T G 2: 146,950,510 probably null Het
Krt12 A T 11: 99,416,013 *488K probably null Het
Lap3 A T 5: 45,496,948 T83S probably benign Het
Lars2 T A 9: 123,431,993 S410T probably damaging Het
Limch1 A G 5: 67,017,658 T518A probably benign Het
Lrrc49 A T 9: 60,615,156 S381T probably damaging Het
Lrrk2 A G 15: 91,734,055 D919G possibly damaging Het
Mmp1a A T 9: 7,475,318 S363C probably damaging Het
Mrps22 A C 9: 98,601,471 probably null Het
Mybpc3 T C 2: 91,134,604 I1066T probably benign Het
Myo10 A T 15: 25,723,925 N215I probably damaging Het
Myocd A C 11: 65,218,648 L99R probably damaging Het
Nadk T G 4: 155,589,336 I394S probably damaging Het
Nadsyn1 T C 7: 143,811,215 N251S probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Ncapd2 G A 6: 125,176,670 P694L probably benign Het
Olfr1101 G T 2: 86,988,820 R119S probably damaging Het
Olfr1243 T C 2: 89,527,557 I284M probably damaging Het
Olfr317 A C 11: 58,732,745 L140R probably damaging Het
Olfr705 T A 7: 106,873,868 I126F probably damaging Het
Pcdhb13 T A 18: 37,443,256 I229K probably damaging Het
Pgbd5 A T 8: 124,374,317 M400K possibly damaging Het
Phactr3 A G 2: 178,302,736 N409S probably damaging Het
Pik3c2g C A 6: 139,629,870 P305Q probably damaging Het
Pik3r4 G A 9: 105,650,584 V379M probably damaging Het
Pkd1l2 A T 8: 117,076,131 C250* probably null Het
Pramef17 A C 4: 143,991,533 S447A probably benign Het
Rapgef6 A C 11: 54,657,365 T792P possibly damaging Het
Rexo5 A G 7: 119,805,191 D170G probably damaging Het
Rnf17 G A 14: 56,512,332 probably null Het
Sept11 A G 5: 93,156,866 I181V probably benign Het
Serpina1e T G 12: 103,947,018 *414C probably null Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3bp2 A G 5: 34,561,631 N560S probably benign Het
Slc25a25 A G 2: 32,419,166 F221S probably damaging Het
Spag17 G T 3: 100,027,401 probably null Het
Sspn T C 6: 145,961,155 L104P probably damaging Het
St6galnac3 T C 3: 153,411,532 I185V possibly damaging Het
St8sia1 T C 6: 142,876,669 D156G probably damaging Het
Syne2 C A 12: 76,005,378 S4092R probably benign Het
Tll1 T A 8: 64,124,945 D76V possibly damaging Het
Tmco1 C T 1: 167,308,453 probably benign Het
Tnfaip3 T A 10: 19,007,281 T179S probably benign Het
Trav16 T C 14: 53,743,639 I95T possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Unc79 A G 12: 103,142,626 M2166V probably benign Het
Vmn2r1 A G 3: 64,089,941 I339M probably damaging Het
Vwa5b1 A G 4: 138,605,431 probably null Het
Washc4 A T 10: 83,573,774 probably null Het
Wisp1 T A 15: 66,913,030 V184E probably damaging Het
Wiz A G 17: 32,357,628 S642P possibly damaging Het
Zeb2 T A 2: 45,110,041 K60N possibly damaging Het
Zfat T A 15: 68,178,782 T797S probably benign Het
Zfp74 T C 7: 29,935,165 K373E probably damaging Het
Zswim5 T C 4: 116,975,976 probably null Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7334:St18 UTSW 1 6802559 missense probably benign 0.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
R8690:St18 UTSW 1 6802564 missense probably benign
R8753:St18 UTSW 1 6845791 missense probably damaging 1.00
R8808:St18 UTSW 1 6810602 missense probably damaging 1.00
R8880:St18 UTSW 1 6795395 nonsense probably null
R9055:St18 UTSW 1 6802982 nonsense probably null
R9292:St18 UTSW 1 6827882 missense probably benign 0.32
R9322:St18 UTSW 1 6795523 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATGTCTTAAAGCCAAACTC -3'
(R):5'- TTTGGAAGCTCCTGTAGTGCAG -3'

Sequencing Primer
(F):5'- TCAAACCTGACACCAGTAGTTTC -3'
(R):5'- AGCTCCTGTAGTGCAGAGCTG -3'
Posted On 2019-05-15